ID: 922834918

View in Genome Browser
Species Human (GRCh38)
Location 1:228620559-228620581
Sequence TCCGGGCCCGCCCGGTGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922834918_922834929 9 Left 922834918 1:228620559-228620581 CCGTGGCACCGGGCGGGCCCGGA No data
Right 922834929 1:228620591-228620613 CTCTGGCGAGTCCTCGGGACTGG No data
922834918_922834932 29 Left 922834918 1:228620559-228620581 CCGTGGCACCGGGCGGGCCCGGA No data
Right 922834932 1:228620611-228620633 TGGAGTCGTCGACACGCAGCGGG No data
922834918_922834923 -8 Left 922834918 1:228620559-228620581 CCGTGGCACCGGGCGGGCCCGGA No data
Right 922834923 1:228620574-228620596 GGCCCGGAGGCCTGGGTCTCTGG No data
922834918_922834931 28 Left 922834918 1:228620559-228620581 CCGTGGCACCGGGCGGGCCCGGA No data
Right 922834931 1:228620610-228620632 CTGGAGTCGTCGACACGCAGCGG No data
922834918_922834928 4 Left 922834918 1:228620559-228620581 CCGTGGCACCGGGCGGGCCCGGA No data
Right 922834928 1:228620586-228620608 TGGGTCTCTGGCGAGTCCTCGGG No data
922834918_922834927 3 Left 922834918 1:228620559-228620581 CCGTGGCACCGGGCGGGCCCGGA No data
Right 922834927 1:228620585-228620607 CTGGGTCTCTGGCGAGTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922834918 Original CRISPR TCCGGGCCCGCCCGGTGCCA CGG (reversed) Intergenic