ID: 922834922

View in Genome Browser
Species Human (GRCh38)
Location 1:228620567-228620589
Sequence CCGGGCGGGCCCGGAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922834903_922834922 24 Left 922834903 1:228620520-228620542 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922834922 1:228620567-228620589 CCGGGCGGGCCCGGAGGCCTGGG No data
922834904_922834922 23 Left 922834904 1:228620521-228620543 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922834922 1:228620567-228620589 CCGGGCGGGCCCGGAGGCCTGGG No data
922834909_922834922 3 Left 922834909 1:228620541-228620563 CCGCCCGTTTGGCGGGAGCCGTG No data
Right 922834922 1:228620567-228620589 CCGGGCGGGCCCGGAGGCCTGGG No data
922834908_922834922 4 Left 922834908 1:228620540-228620562 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922834922 1:228620567-228620589 CCGGGCGGGCCCGGAGGCCTGGG No data
922834912_922834922 -1 Left 922834912 1:228620545-228620567 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922834922 1:228620567-228620589 CCGGGCGGGCCCGGAGGCCTGGG No data
922834911_922834922 0 Left 922834911 1:228620544-228620566 CCCGTTTGGCGGGAGCCGTGGCA No data
Right 922834922 1:228620567-228620589 CCGGGCGGGCCCGGAGGCCTGGG No data
922834902_922834922 25 Left 922834902 1:228620519-228620541 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922834922 1:228620567-228620589 CCGGGCGGGCCCGGAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922834922 Original CRISPR CCGGGCGGGCCCGGAGGCCT GGG Intergenic
No off target data available for this crispr