ID: 922834923

View in Genome Browser
Species Human (GRCh38)
Location 1:228620574-228620596
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922834909_922834923 10 Left 922834909 1:228620541-228620563 CCGCCCGTTTGGCGGGAGCCGTG No data
Right 922834923 1:228620574-228620596 GGCCCGGAGGCCTGGGTCTCTGG No data
922834918_922834923 -8 Left 922834918 1:228620559-228620581 CCGTGGCACCGGGCGGGCCCGGA No data
Right 922834923 1:228620574-228620596 GGCCCGGAGGCCTGGGTCTCTGG No data
922834908_922834923 11 Left 922834908 1:228620540-228620562 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922834923 1:228620574-228620596 GGCCCGGAGGCCTGGGTCTCTGG No data
922834912_922834923 6 Left 922834912 1:228620545-228620567 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922834923 1:228620574-228620596 GGCCCGGAGGCCTGGGTCTCTGG No data
922834904_922834923 30 Left 922834904 1:228620521-228620543 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922834923 1:228620574-228620596 GGCCCGGAGGCCTGGGTCTCTGG No data
922834911_922834923 7 Left 922834911 1:228620544-228620566 CCCGTTTGGCGGGAGCCGTGGCA No data
Right 922834923 1:228620574-228620596 GGCCCGGAGGCCTGGGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr