ID: 922834929

View in Genome Browser
Species Human (GRCh38)
Location 1:228620591-228620613
Sequence CTCTGGCGAGTCCTCGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922834921_922834929 1 Left 922834921 1:228620567-228620589 CCGGGCGGGCCCGGAGGCCTGGG No data
Right 922834929 1:228620591-228620613 CTCTGGCGAGTCCTCGGGACTGG No data
922834908_922834929 28 Left 922834908 1:228620540-228620562 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922834929 1:228620591-228620613 CTCTGGCGAGTCCTCGGGACTGG No data
922834925_922834929 -9 Left 922834925 1:228620577-228620599 CCGGAGGCCTGGGTCTCTGGCGA No data
Right 922834929 1:228620591-228620613 CTCTGGCGAGTCCTCGGGACTGG No data
922834924_922834929 -8 Left 922834924 1:228620576-228620598 CCCGGAGGCCTGGGTCTCTGGCG No data
Right 922834929 1:228620591-228620613 CTCTGGCGAGTCCTCGGGACTGG No data
922834909_922834929 27 Left 922834909 1:228620541-228620563 CCGCCCGTTTGGCGGGAGCCGTG No data
Right 922834929 1:228620591-228620613 CTCTGGCGAGTCCTCGGGACTGG No data
922834911_922834929 24 Left 922834911 1:228620544-228620566 CCCGTTTGGCGGGAGCCGTGGCA No data
Right 922834929 1:228620591-228620613 CTCTGGCGAGTCCTCGGGACTGG No data
922834912_922834929 23 Left 922834912 1:228620545-228620567 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922834929 1:228620591-228620613 CTCTGGCGAGTCCTCGGGACTGG No data
922834918_922834929 9 Left 922834918 1:228620559-228620581 CCGTGGCACCGGGCGGGCCCGGA No data
Right 922834929 1:228620591-228620613 CTCTGGCGAGTCCTCGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922834929 Original CRISPR CTCTGGCGAGTCCTCGGGAC TGG Intergenic
No off target data available for this crispr