ID: 922834976

View in Genome Browser
Species Human (GRCh38)
Location 1:228620776-228620798
Sequence CACCCTTCCAAACCGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922834976_922834989 24 Left 922834976 1:228620776-228620798 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922834989 1:228620823-228620845 TTGAATCACCTGGGCGTTCCGGG No data
922834976_922834988 23 Left 922834976 1:228620776-228620798 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922834988 1:228620822-228620844 ATTGAATCACCTGGGCGTTCCGG No data
922834976_922834991 30 Left 922834976 1:228620776-228620798 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922834991 1:228620829-228620851 CACCTGGGCGTTCCGGGAGCGGG No data
922834976_922834987 15 Left 922834976 1:228620776-228620798 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922834987 1:228620814-228620836 ATGGGTGAATTGAATCACCTGGG No data
922834976_922834983 -3 Left 922834976 1:228620776-228620798 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922834983 1:228620796-228620818 GTGCGACGACGGCGCCCGATGGG No data
922834976_922834982 -4 Left 922834976 1:228620776-228620798 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922834982 1:228620795-228620817 GGTGCGACGACGGCGCCCGATGG No data
922834976_922834990 29 Left 922834976 1:228620776-228620798 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922834990 1:228620828-228620850 TCACCTGGGCGTTCCGGGAGCGG No data
922834976_922834986 14 Left 922834976 1:228620776-228620798 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922834986 1:228620813-228620835 GATGGGTGAATTGAATCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922834976 Original CRISPR CACCCTTCCAAACCGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr