ID: 922835472

View in Genome Browser
Species Human (GRCh38)
Location 1:228622770-228622792
Sequence CCGGGCGGGCCCGGAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922835458_922835472 4 Left 922835458 1:228622743-228622765 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922835472 1:228622770-228622792 CCGGGCGGGCCCGGAGGCCTGGG No data
922835462_922835472 -1 Left 922835462 1:228622748-228622770 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922835472 1:228622770-228622792 CCGGGCGGGCCCGGAGGCCTGGG No data
922835453_922835472 24 Left 922835453 1:228622723-228622745 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922835472 1:228622770-228622792 CCGGGCGGGCCCGGAGGCCTGGG No data
922835459_922835472 3 Left 922835459 1:228622744-228622766 CCGCCCGTTTGGCGGGAGCCGTG No data
Right 922835472 1:228622770-228622792 CCGGGCGGGCCCGGAGGCCTGGG No data
922835454_922835472 23 Left 922835454 1:228622724-228622746 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922835472 1:228622770-228622792 CCGGGCGGGCCCGGAGGCCTGGG No data
922835461_922835472 0 Left 922835461 1:228622747-228622769 CCCGTTTGGCGGGAGCCGTGGCA No data
Right 922835472 1:228622770-228622792 CCGGGCGGGCCCGGAGGCCTGGG No data
922835452_922835472 25 Left 922835452 1:228622722-228622744 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922835472 1:228622770-228622792 CCGGGCGGGCCCGGAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922835472 Original CRISPR CCGGGCGGGCCCGGAGGCCT GGG Intergenic
No off target data available for this crispr