ID: 922835527

View in Genome Browser
Species Human (GRCh38)
Location 1:228622979-228623001
Sequence CACCCTTCCAAACCGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922835527_922835533 -4 Left 922835527 1:228622979-228623001 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922835533 1:228622998-228623020 GGTGCGACGACGGCGCCCGATGG No data
922835527_922835539 23 Left 922835527 1:228622979-228623001 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922835539 1:228623025-228623047 ATTGAATCGCCTGGGCGTTCCGG No data
922835527_922835542 30 Left 922835527 1:228622979-228623001 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922835542 1:228623032-228623054 CGCCTGGGCGTTCCGGGAGCGGG No data
922835527_922835538 15 Left 922835527 1:228622979-228623001 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922835538 1:228623017-228623039 ATGGGTGAATTGAATCGCCTGGG No data
922835527_922835541 29 Left 922835527 1:228622979-228623001 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922835541 1:228623031-228623053 TCGCCTGGGCGTTCCGGGAGCGG No data
922835527_922835540 24 Left 922835527 1:228622979-228623001 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922835540 1:228623026-228623048 TTGAATCGCCTGGGCGTTCCGGG No data
922835527_922835534 -3 Left 922835527 1:228622979-228623001 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922835534 1:228622999-228623021 GTGCGACGACGGCGCCCGATGGG No data
922835527_922835537 14 Left 922835527 1:228622979-228623001 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922835537 1:228623016-228623038 GATGGGTGAATTGAATCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922835527 Original CRISPR CACCCTTCCAAACCGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr