ID: 922836085

View in Genome Browser
Species Human (GRCh38)
Location 1:228625221-228625243
Sequence CACCCTTCCAAACCGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922836085_922836092 -3 Left 922836085 1:228625221-228625243 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922836092 1:228625241-228625263 GTGCGACGACGGCGCCCGATGGG No data
922836085_922836098 24 Left 922836085 1:228625221-228625243 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922836098 1:228625268-228625290 TTGAATCGCCTGGGCGTTCCGGG No data
922836085_922836099 29 Left 922836085 1:228625221-228625243 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922836099 1:228625273-228625295 TCGCCTGGGCGTTCCGGGAGCGG No data
922836085_922836091 -4 Left 922836085 1:228625221-228625243 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922836091 1:228625240-228625262 GGTGCGACGACGGCGCCCGATGG No data
922836085_922836095 14 Left 922836085 1:228625221-228625243 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922836095 1:228625258-228625280 GATGGGTGAATTGAATCGCCTGG No data
922836085_922836096 15 Left 922836085 1:228625221-228625243 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922836096 1:228625259-228625281 ATGGGTGAATTGAATCGCCTGGG No data
922836085_922836097 23 Left 922836085 1:228625221-228625243 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922836097 1:228625267-228625289 ATTGAATCGCCTGGGCGTTCCGG No data
922836085_922836100 30 Left 922836085 1:228625221-228625243 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922836100 1:228625274-228625296 CGCCTGGGCGTTCCGGGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922836085 Original CRISPR CACCCTTCCAAACCGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr