ID: 922836587

View in Genome Browser
Species Human (GRCh38)
Location 1:228627252-228627274
Sequence CCGGGCGGGCCCGGAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922836576_922836587 0 Left 922836576 1:228627229-228627251 CCCGTTTGGCGGGAGCCGTGGCA No data
Right 922836587 1:228627252-228627274 CCGGGCGGGCCCGGAGGCCTGGG No data
922836573_922836587 4 Left 922836573 1:228627225-228627247 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922836587 1:228627252-228627274 CCGGGCGGGCCCGGAGGCCTGGG No data
922836567_922836587 25 Left 922836567 1:228627204-228627226 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922836587 1:228627252-228627274 CCGGGCGGGCCCGGAGGCCTGGG No data
922836574_922836587 3 Left 922836574 1:228627226-228627248 CCGCCCGTTTGGCGGGAGCCGTG No data
Right 922836587 1:228627252-228627274 CCGGGCGGGCCCGGAGGCCTGGG No data
922836568_922836587 24 Left 922836568 1:228627205-228627227 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922836587 1:228627252-228627274 CCGGGCGGGCCCGGAGGCCTGGG No data
922836577_922836587 -1 Left 922836577 1:228627230-228627252 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922836587 1:228627252-228627274 CCGGGCGGGCCCGGAGGCCTGGG No data
922836569_922836587 23 Left 922836569 1:228627206-228627228 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922836587 1:228627252-228627274 CCGGGCGGGCCCGGAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922836587 Original CRISPR CCGGGCGGGCCCGGAGGCCT GGG Intergenic
No off target data available for this crispr