ID: 922836643

View in Genome Browser
Species Human (GRCh38)
Location 1:228627460-228627482
Sequence CACCCTTCCAAACCGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922836643_922836655 23 Left 922836643 1:228627460-228627482 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922836655 1:228627506-228627528 ATTGAATCGCCTGGGCGTTCCGG No data
922836643_922836658 30 Left 922836643 1:228627460-228627482 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922836658 1:228627513-228627535 CGCCTGGGCGTTCCGGGAGCGGG No data
922836643_922836650 -3 Left 922836643 1:228627460-228627482 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922836650 1:228627480-228627502 GTGCGACGACGGCGCCCGATGGG No data
922836643_922836653 14 Left 922836643 1:228627460-228627482 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922836653 1:228627497-228627519 GATGGGTGAATTGAATCGCCTGG No data
922836643_922836654 15 Left 922836643 1:228627460-228627482 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922836654 1:228627498-228627520 ATGGGTGAATTGAATCGCCTGGG No data
922836643_922836657 29 Left 922836643 1:228627460-228627482 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922836657 1:228627512-228627534 TCGCCTGGGCGTTCCGGGAGCGG No data
922836643_922836649 -4 Left 922836643 1:228627460-228627482 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922836649 1:228627479-228627501 GGTGCGACGACGGCGCCCGATGG No data
922836643_922836656 24 Left 922836643 1:228627460-228627482 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922836656 1:228627507-228627529 TTGAATCGCCTGGGCGTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922836643 Original CRISPR CACCCTTCCAAACCGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr