ID: 922837147

View in Genome Browser
Species Human (GRCh38)
Location 1:228629493-228629515
Sequence CCGGGCGGGCCCGGAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922837127_922837147 25 Left 922837127 1:228629445-228629467 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922837147 1:228629493-228629515 CCGGGCGGGCCCGGAGGCCTGGG No data
922837137_922837147 -1 Left 922837137 1:228629471-228629493 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922837147 1:228629493-228629515 CCGGGCGGGCCCGGAGGCCTGGG No data
922837133_922837147 4 Left 922837133 1:228629466-228629488 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922837147 1:228629493-228629515 CCGGGCGGGCCCGGAGGCCTGGG No data
922837136_922837147 0 Left 922837136 1:228629470-228629492 CCCGTTTGGCGGGAGCCGTGGCA No data
Right 922837147 1:228629493-228629515 CCGGGCGGGCCCGGAGGCCTGGG No data
922837129_922837147 23 Left 922837129 1:228629447-228629469 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922837147 1:228629493-228629515 CCGGGCGGGCCCGGAGGCCTGGG No data
922837134_922837147 3 Left 922837134 1:228629467-228629489 CCGCCCGTTTGGCGGGAGCCGTG No data
Right 922837147 1:228629493-228629515 CCGGGCGGGCCCGGAGGCCTGGG No data
922837128_922837147 24 Left 922837128 1:228629446-228629468 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922837147 1:228629493-228629515 CCGGGCGGGCCCGGAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922837147 Original CRISPR CCGGGCGGGCCCGGAGGCCT GGG Intergenic
No off target data available for this crispr