ID: 922837202

View in Genome Browser
Species Human (GRCh38)
Location 1:228629702-228629724
Sequence CACCCTTCCAAACCGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922837202_922837215 24 Left 922837202 1:228629702-228629724 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922837215 1:228629749-228629771 TTGAATCGCCTGGGCGTTCCGGG No data
922837202_922837209 -3 Left 922837202 1:228629702-228629724 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922837209 1:228629722-228629744 GTGCGACGACGGCGCCCGATGGG No data
922837202_922837208 -4 Left 922837202 1:228629702-228629724 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922837208 1:228629721-228629743 GGTGCGACGACGGCGCCCGATGG No data
922837202_922837216 29 Left 922837202 1:228629702-228629724 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922837216 1:228629754-228629776 TCGCCTGGGCGTTCCGGGAGCGG No data
922837202_922837213 15 Left 922837202 1:228629702-228629724 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922837213 1:228629740-228629762 ATGGGTGAATTGAATCGCCTGGG No data
922837202_922837214 23 Left 922837202 1:228629702-228629724 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922837214 1:228629748-228629770 ATTGAATCGCCTGGGCGTTCCGG No data
922837202_922837212 14 Left 922837202 1:228629702-228629724 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922837212 1:228629739-228629761 GATGGGTGAATTGAATCGCCTGG No data
922837202_922837217 30 Left 922837202 1:228629702-228629724 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922837217 1:228629755-228629777 CGCCTGGGCGTTCCGGGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922837202 Original CRISPR CACCCTTCCAAACCGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr