ID: 922837763

View in Genome Browser
Species Human (GRCh38)
Location 1:228631943-228631965
Sequence CACCCTTCCAAACCGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922837763_922837773 14 Left 922837763 1:228631943-228631965 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922837773 1:228631980-228632002 GATGGGTGAATTGAATCGCCTGG No data
922837763_922837776 24 Left 922837763 1:228631943-228631965 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922837776 1:228631990-228632012 TTGAATCGCCTGGGCGTTCCGGG No data
922837763_922837777 29 Left 922837763 1:228631943-228631965 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922837777 1:228631995-228632017 TCGCCTGGGCGTTCCGGGAGCGG No data
922837763_922837778 30 Left 922837763 1:228631943-228631965 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922837778 1:228631996-228632018 CGCCTGGGCGTTCCGGGAGCGGG No data
922837763_922837770 -3 Left 922837763 1:228631943-228631965 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922837770 1:228631963-228631985 GTGCGACGACGGCGCCCGATGGG No data
922837763_922837774 15 Left 922837763 1:228631943-228631965 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922837774 1:228631981-228632003 ATGGGTGAATTGAATCGCCTGGG No data
922837763_922837775 23 Left 922837763 1:228631943-228631965 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922837775 1:228631989-228632011 ATTGAATCGCCTGGGCGTTCCGG No data
922837763_922837769 -4 Left 922837763 1:228631943-228631965 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922837769 1:228631962-228631984 GGTGCGACGACGGCGCCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922837763 Original CRISPR CACCCTTCCAAACCGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr