ID: 922838265

View in Genome Browser
Species Human (GRCh38)
Location 1:228633975-228633997
Sequence CCGGGCGGGCCCGGAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922838255_922838265 -1 Left 922838255 1:228633953-228633975 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922838265 1:228633975-228633997 CCGGGCGGGCCCGGAGGCCTGGG No data
922838245_922838265 25 Left 922838245 1:228633927-228633949 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922838265 1:228633975-228633997 CCGGGCGGGCCCGGAGGCCTGGG No data
922838247_922838265 23 Left 922838247 1:228633929-228633951 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922838265 1:228633975-228633997 CCGGGCGGGCCCGGAGGCCTGGG No data
922838252_922838265 3 Left 922838252 1:228633949-228633971 CCGCCCGTTTGGCGGGAGCCGTG No data
Right 922838265 1:228633975-228633997 CCGGGCGGGCCCGGAGGCCTGGG No data
922838254_922838265 0 Left 922838254 1:228633952-228633974 CCCGTTTGGCGGGAGCCGTGGCA No data
Right 922838265 1:228633975-228633997 CCGGGCGGGCCCGGAGGCCTGGG No data
922838246_922838265 24 Left 922838246 1:228633928-228633950 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922838265 1:228633975-228633997 CCGGGCGGGCCCGGAGGCCTGGG No data
922838251_922838265 4 Left 922838251 1:228633948-228633970 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922838265 1:228633975-228633997 CCGGGCGGGCCCGGAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922838265 Original CRISPR CCGGGCGGGCCCGGAGGCCT GGG Intergenic
No off target data available for this crispr