ID: 922838321

View in Genome Browser
Species Human (GRCh38)
Location 1:228634183-228634205
Sequence CACCCTTCCAAACCGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922838321_922838332 15 Left 922838321 1:228634183-228634205 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922838332 1:228634221-228634243 ATGGGTGAATTGAATCGCCTGGG No data
922838321_922838331 14 Left 922838321 1:228634183-228634205 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922838331 1:228634220-228634242 GATGGGTGAATTGAATCGCCTGG No data
922838321_922838327 -4 Left 922838321 1:228634183-228634205 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922838327 1:228634202-228634224 GGTGCGACGACGGCGCCCGATGG No data
922838321_922838333 23 Left 922838321 1:228634183-228634205 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922838333 1:228634229-228634251 ATTGAATCGCCTGGGCGTTCCGG No data
922838321_922838328 -3 Left 922838321 1:228634183-228634205 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922838328 1:228634203-228634225 GTGCGACGACGGCGCCCGATGGG No data
922838321_922838336 30 Left 922838321 1:228634183-228634205 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922838336 1:228634236-228634258 CGCCTGGGCGTTCCGGGAGCGGG No data
922838321_922838335 29 Left 922838321 1:228634183-228634205 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922838335 1:228634235-228634257 TCGCCTGGGCGTTCCGGGAGCGG No data
922838321_922838334 24 Left 922838321 1:228634183-228634205 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922838334 1:228634230-228634252 TTGAATCGCCTGGGCGTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922838321 Original CRISPR CACCCTTCCAAACCGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr