ID: 922838824

View in Genome Browser
Species Human (GRCh38)
Location 1:228636200-228636222
Sequence CCGGGCGGGCCCGGAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922838814_922838824 -1 Left 922838814 1:228636178-228636200 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922838824 1:228636200-228636222 CCGGGCGGGCCCGGAGGCCTGGG No data
922838804_922838824 25 Left 922838804 1:228636152-228636174 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922838824 1:228636200-228636222 CCGGGCGGGCCCGGAGGCCTGGG No data
922838806_922838824 23 Left 922838806 1:228636154-228636176 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922838824 1:228636200-228636222 CCGGGCGGGCCCGGAGGCCTGGG No data
922838813_922838824 0 Left 922838813 1:228636177-228636199 CCCGTTTGGCGGGAGCCGTGGCA No data
Right 922838824 1:228636200-228636222 CCGGGCGGGCCCGGAGGCCTGGG No data
922838811_922838824 3 Left 922838811 1:228636174-228636196 CCGCCCGTTTGGCGGGAGCCGTG No data
Right 922838824 1:228636200-228636222 CCGGGCGGGCCCGGAGGCCTGGG No data
922838805_922838824 24 Left 922838805 1:228636153-228636175 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922838824 1:228636200-228636222 CCGGGCGGGCCCGGAGGCCTGGG No data
922838810_922838824 4 Left 922838810 1:228636173-228636195 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922838824 1:228636200-228636222 CCGGGCGGGCCCGGAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922838824 Original CRISPR CCGGGCGGGCCCGGAGGCCT GGG Intergenic
No off target data available for this crispr