ID: 922838864

View in Genome Browser
Species Human (GRCh38)
Location 1:228636362-228636384
Sequence ACAGACGCCAGCCAAGACGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922838864_922838869 11 Left 922838864 1:228636362-228636384 CCGACGTCTTGGCTGGCGTCTGT No data
Right 922838869 1:228636396-228636418 CCCCTGCCCGCCCCTTCCCCCGG 0: 23
1: 2
2: 16
3: 162
4: 1155
922838864_922838877 21 Left 922838864 1:228636362-228636384 CCGACGTCTTGGCTGGCGTCTGT No data
Right 922838877 1:228636406-228636428 CCCCTTCCCCCGGTTTGGAAGGG No data
922838864_922838872 16 Left 922838864 1:228636362-228636384 CCGACGTCTTGGCTGGCGTCTGT No data
Right 922838872 1:228636401-228636423 GCCCGCCCCTTCCCCCGGTTTGG No data
922838864_922838875 20 Left 922838864 1:228636362-228636384 CCGACGTCTTGGCTGGCGTCTGT No data
Right 922838875 1:228636405-228636427 GCCCCTTCCCCCGGTTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922838864 Original CRISPR ACAGACGCCAGCCAAGACGT CGG (reversed) Intergenic
No off target data available for this crispr