ID: 922838867

View in Genome Browser
Species Human (GRCh38)
Location 1:228636390-228636412
Sequence GAAGGGGCGGGCAGGGGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922838867_922838886 15 Left 922838867 1:228636390-228636412 CCGCTGCCCCTGCCCGCCCCTTC No data
Right 922838886 1:228636428-228636450 GTGCGACGACGGCGCCCGATGGG No data
922838867_922838884 4 Left 922838867 1:228636390-228636412 CCGCTGCCCCTGCCCGCCCCTTC No data
Right 922838884 1:228636417-228636439 GGTTTGGAAGGGTGCGACGACGG No data
922838867_922838885 14 Left 922838867 1:228636390-228636412 CCGCTGCCCCTGCCCGCCCCTTC No data
Right 922838885 1:228636427-228636449 GGTGCGACGACGGCGCCCGATGG No data
922838867_922838877 -7 Left 922838867 1:228636390-228636412 CCGCTGCCCCTGCCCGCCCCTTC No data
Right 922838877 1:228636406-228636428 CCCCTTCCCCCGGTTTGGAAGGG No data
922838867_922838875 -8 Left 922838867 1:228636390-228636412 CCGCTGCCCCTGCCCGCCCCTTC No data
Right 922838875 1:228636405-228636427 GCCCCTTCCCCCGGTTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922838867 Original CRISPR GAAGGGGCGGGCAGGGGCAG CGG (reversed) Intergenic
No off target data available for this crispr