ID: 922838868

View in Genome Browser
Species Human (GRCh38)
Location 1:228636396-228636418
Sequence CCGGGGGAAGGGGCGGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1311
Summary {0: 22, 1: 4, 2: 8, 3: 139, 4: 1138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922838868_922838889 26 Left 922838868 1:228636396-228636418 CCCCTGCCCGCCCCTTCCCCCGG 0: 22
1: 4
2: 8
3: 139
4: 1138
Right 922838889 1:228636445-228636467 GATGGGTGAATTGAATCACCTGG No data
922838868_922838884 -2 Left 922838868 1:228636396-228636418 CCCCTGCCCGCCCCTTCCCCCGG 0: 22
1: 4
2: 8
3: 139
4: 1138
Right 922838884 1:228636417-228636439 GGTTTGGAAGGGTGCGACGACGG No data
922838868_922838890 27 Left 922838868 1:228636396-228636418 CCCCTGCCCGCCCCTTCCCCCGG 0: 22
1: 4
2: 8
3: 139
4: 1138
Right 922838890 1:228636446-228636468 ATGGGTGAATTGAATCACCTGGG No data
922838868_922838885 8 Left 922838868 1:228636396-228636418 CCCCTGCCCGCCCCTTCCCCCGG 0: 22
1: 4
2: 8
3: 139
4: 1138
Right 922838885 1:228636427-228636449 GGTGCGACGACGGCGCCCGATGG No data
922838868_922838886 9 Left 922838868 1:228636396-228636418 CCCCTGCCCGCCCCTTCCCCCGG 0: 22
1: 4
2: 8
3: 139
4: 1138
Right 922838886 1:228636428-228636450 GTGCGACGACGGCGCCCGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922838868 Original CRISPR CCGGGGGAAGGGGCGGGCAG GGG (reversed) Intergenic
900185462 1:1331257-1331279 CCGGGGCGGGGAGCGGGCAGAGG - Intergenic
900212316 1:1462200-1462222 CCCAGGGAAGGGGAGGGCATAGG - Intronic
900224986 1:1528819-1528841 CCCAGGGAAGGGGAGGGCATAGG - Intronic
900344546 1:2204848-2204870 CCGGGAGGAGGGTCCGGCAGAGG - Intronic
900344640 1:2205059-2205081 CCGGGGGAAGGGCGGGGCTTGGG - Intronic
900387971 1:2419295-2419317 CTGAGGGAAGGGGCTGGCAGGGG - Intergenic
900402218 1:2477252-2477274 CAGGGGCAGGGGGCGGGCAGAGG - Intronic
900402347 1:2477713-2477735 CCTGGGGGAGGGGAGGGGAGGGG + Intronic
900413968 1:2526692-2526714 CCGGGGGTGGGGGAGGGAAGGGG - Intergenic
900429288 1:2594295-2594317 CAGGAGGAAGGGATGGGCAGGGG + Intronic
900491582 1:2951930-2951952 CAGGCGGAAGGGGCAGGCATTGG + Intergenic
900556771 1:3284582-3284604 GCAGGGAAAGGGGCGGCCAGGGG + Intronic
900806551 1:4771438-4771460 GAAGGGGAAGGGGCGGGCAGGGG + Intronic
900974332 1:6007811-6007833 CCAAGGGAAGCGGCGGGCACAGG - Intronic
900988542 1:6087042-6087064 CAGGGGGCAGGGGCGGGCTCTGG - Intronic
900998432 1:6135180-6135202 CCAGGGGAAAGGGCGAGCACAGG + Intronic
901086440 1:6614481-6614503 CCGGAGCCAGGGGCGGGCGGCGG - Intronic
901178529 1:7322948-7322970 ACGGAGGAAGGGGAGGGGAGGGG - Intronic
901244112 1:7715170-7715192 CCGGGGGAATGGGCTGGGACAGG + Intronic
901373055 1:8817210-8817232 CCGGGGAAAGTGGCGGGGATGGG + Exonic
901565299 1:10109196-10109218 CAGGGGGAACGGGGGGGCCGGGG + Intronic
901608116 1:10475157-10475179 CCGGGGGGAGGGGCCGGGTGGGG - Intronic
901640562 1:10691002-10691024 CTGGGGGAGGGAGCGGGAAGGGG - Intronic
901739049 1:11330388-11330410 GCTGGGGCAGGGGCGGCCAGGGG + Intergenic
901832016 1:11898538-11898560 GCGTGGGGAGGGGCGGGGAGCGG + Intergenic
901880480 1:12191120-12191142 CCGGGGGAAGTTGGAGGCAGGGG - Intronic
902219885 1:14958098-14958120 CCAGGGGAGGGAGCAGGCAGAGG - Intronic
902238635 1:15073934-15073956 CCAAGGGCAGGGGTGGGCAGAGG - Intronic
902289945 1:15429149-15429171 GCCTGGGAAGGGGCTGGCAGGGG - Exonic
902387312 1:16083304-16083326 GCTGAGGAAGGGGCTGGCAGGGG - Intergenic
902553028 1:17230475-17230497 CCTGGGGCAGGGCAGGGCAGCGG - Intronic
902690631 1:18108256-18108278 CCGGGGGAGGGCGCTGGCCGGGG + Intronic
902718810 1:18290828-18290850 GCGGGGAAAGGGGCAGGGAGGGG - Intronic
902774251 1:18664444-18664466 CCTGGGGAAGGGGAGGGAGGAGG + Intronic
902816184 1:18918010-18918032 CCAGAGGAAGGGGCAGGAAGCGG + Intronic
902821176 1:18944377-18944399 TCGGGGGCCGGGGCGGGGAGAGG + Intronic
902920768 1:19665097-19665119 CCGCGGGAAGAGGAGGGCAGCGG - Intergenic
903270868 1:22187480-22187502 CTGGAGGAAGGGGAGGGGAGAGG - Intergenic
903271035 1:22188450-22188472 CCAGGGTTAGGGGCAGGCAGAGG - Intergenic
903288329 1:22291028-22291050 TCGGGGGATGGGGAGGGGAGGGG - Intergenic
903354982 1:22741030-22741052 CAGGGAGAAGGGGCAGGCAGAGG - Intronic
903386524 1:22930504-22930526 CTGGGGGATGGGGCAGGCAATGG + Intergenic
903542529 1:24105081-24105103 CCTGGGGAGGGGCGGGGCAGGGG - Intronic
903555160 1:24187550-24187572 ACGGGGGAAGGGCAGGGGAGGGG + Intronic
903897851 1:26620599-26620621 CCGGGGGGAGGGGTGCGGAGGGG - Intergenic
904035617 1:27557125-27557147 CCAGGGCAGGGGGCTGGCAGGGG - Intronic
904237668 1:29124888-29124910 CCCGAGGAAGGGGCGGGCCAGGG + Intergenic
904464197 1:30698383-30698405 CCGGGGAAAGAGGCAGCCAGGGG + Intergenic
904585293 1:31576646-31576668 CAGGGGGAGGGGGCAGGTAGAGG + Intronic
904600772 1:31671476-31671498 CGGAGGGATGGGGAGGGCAGTGG + Intronic
904626683 1:31810071-31810093 CAGAGGGGAGGGGAGGGCAGAGG - Intronic
904676402 1:32201597-32201619 CTGGGGGGCGGGGCTGGCAGAGG - Intronic
904696796 1:32335758-32335780 GCGAGGGGAGGGGCGGGGAGGGG - Intronic
904813788 1:33180985-33181007 CCTGGGGAAGGGGCGGGGCCGGG - Intronic
904826390 1:33276289-33276311 CCTGGGCAAGGGGCGGGAGGTGG + Intronic
904842090 1:33379348-33379370 AGGGGGGATGGGGGGGGCAGGGG - Intronic
904842102 1:33379366-33379388 CGGGGGGAAGGGGGGGACAGGGG - Intronic
905212730 1:36385710-36385732 CCCGGCGAAGGTGAGGGCAGGGG - Exonic
905251055 1:36648674-36648696 TCGGGGGAAAGGGTGGGAAGGGG + Intergenic
905422758 1:37859632-37859654 CCGGAGGAAGGTGGGGACAGAGG + Intergenic
905653601 1:39672130-39672152 CGAGGGAAGGGGGCGGGCAGCGG + Intergenic
905773633 1:40654162-40654184 CGCGGGGGAGGGGCGGGGAGGGG - Intronic
905832765 1:41086553-41086575 CCAGGGGCAGGGCAGGGCAGGGG - Intronic
906264427 1:44417749-44417771 CTGGGGGAGGGGGCGCGGAGAGG + Intronic
907052006 1:51335981-51336003 CTGGGGGAAGGGGCTGGGAGGGG - Intronic
907197491 1:52698359-52698381 CCGGCGGAGGGGGCGGGGCGGGG + Exonic
907430240 1:54406953-54406975 CCCGGGGGCGGGGCGGGCTGGGG - Intronic
907662221 1:56403844-56403866 CAGGGGGAAAGGGTGGGAAGGGG + Intergenic
908796139 1:67833113-67833135 CCGGGGGGAGGGGGAGGAAGGGG - Intronic
909403347 1:75258572-75258594 CTGGAGGAAGGGGCGGTCGGGGG + Intronic
910227196 1:84947929-84947951 CCAGGGGCAGGGGCAGGAAGGGG - Intronic
910288927 1:85581381-85581403 CAGGGGGCAGTGGCAGGCAGCGG - Exonic
910664477 1:89709581-89709603 CCGGGGGAGGGTTCAGGCAGGGG + Intronic
910847526 1:91617682-91617704 TCGGGAGAAGGGGCCAGCAGAGG + Intergenic
910940666 1:92530332-92530354 CTGGGGGAAGGGGCGGTTGGGGG + Intronic
912966299 1:114240121-114240143 CCTGGGGAAGGGGGTGGCTGTGG + Intergenic
913246438 1:116874371-116874393 CTGGGGCAAAGGGTGGGCAGAGG - Intergenic
913466358 1:119147234-119147256 TCTGGGGAAGGGGCTGGCGGAGG - Intergenic
914876043 1:151513244-151513266 CAAGGGGAAGGGGAGGGCCGGGG - Intronic
915104814 1:153527281-153527303 CCAGCGGAGGGGGCGGGTAGGGG - Intergenic
915310856 1:155005181-155005203 CCTGGGGAAGGGTGGGGGAGGGG + Intronic
915313437 1:155015825-155015847 AGGGGGGAAGGGCCCGGCAGGGG + Intronic
915462987 1:156080994-156081016 CCTGGGGAAGAGGCGGTGAGGGG - Intronic
915476309 1:156154667-156154689 CCGCGGGGGGAGGCGGGCAGGGG + Exonic
915526746 1:156480779-156480801 TGGGGGGAAGGGGCCGGAAGGGG + Intronic
915940588 1:160116071-160116093 CAGGGGGCTGGGGCGTGCAGAGG - Intronic
916123392 1:161549110-161549132 CCTGGGGCAGAGGAGGGCAGGGG - Intronic
916133284 1:161630468-161630490 CCTGGGGCAGAGGAGGGCAGGGG - Intronic
916515620 1:165513792-165513814 TCGGGGGAAATGGTGGGCAGTGG - Intergenic
916671643 1:167027401-167027423 CAGGGGGAAAGGGTGGGAAGGGG + Intergenic
916783022 1:168056470-168056492 CCGGGAGGCGGGGCGGGGAGGGG + Intronic
917625343 1:176840285-176840307 CCTGGGGATGGGGGAGGCAGTGG + Intronic
917829096 1:178859811-178859833 GGGGGGGGGGGGGCGGGCAGAGG - Intronic
917974516 1:180230222-180230244 GAGGGGGAAGGAGCGGGCGGGGG + Intergenic
919464313 1:197911958-197911980 GAGGAGGAAGGGGTGGGCAGAGG - Intronic
919601947 1:199633388-199633410 CTGGGGGAAGGGGCGGCTATGGG + Intergenic
919726981 1:200891062-200891084 CCGGGGCCAGGGCCGGGGAGAGG + Intronic
919741853 1:200985767-200985789 GAGGGGGAAGGGGAGGGGAGTGG - Intronic
919761224 1:201099368-201099390 GCCTGGGAAGGGGCTGGCAGAGG + Intronic
919775389 1:201190991-201191013 ACGCAGGAAGGGGCAGGCAGTGG + Intronic
919929920 1:202214424-202214446 GCGCGGGCAGGGGCGGGCAGGGG + Intronic
919931105 1:202222157-202222179 CCAGGGGAAGGGGAAGGAAGAGG - Intronic
920234694 1:204494855-204494877 GAGGGGGAAGGGGAGGGGAGAGG - Intergenic
920290779 1:204921544-204921566 CTGGGGGGAGGGGCGTGGAGAGG + Intronic
920339839 1:205268927-205268949 CTGGGGAAAGAGGCAGGCAGAGG - Intronic
920496946 1:206461603-206461625 CTGGGGGAAGCAGAGGGCAGTGG - Exonic
920666114 1:207963983-207964005 CCAGGGGAGGGGGCAGGCGGTGG - Intergenic
921217905 1:212952223-212952245 CTGGGGGAAGAGGGGAGCAGAGG - Intronic
922675984 1:227550276-227550298 CTGGGGGAAGGGGCGGCTATGGG + Intergenic
922676852 1:227558713-227558735 CTGGGGGAAGGGGCGGGCAGGGG + Intergenic
922677516 1:227561650-227561672 CCGGGGGAAGGGGCGGGCAGGGG + Intergenic
922753786 1:228083032-228083054 GCGGGGGCAGGGACAGGCAGAGG - Intronic
922801979 1:228368611-228368633 CCGGGGGCAGGGTGGGACAGTGG - Intronic
922831689 1:228557586-228557608 CCGGGTGAAGGGGCGGGCAGGGG - Intergenic
922832167 1:228609568-228609590 CCGGGGGAAGGGGCGGGCAGGGG - Intergenic
922832727 1:228611809-228611831 CCGGGGGAAGGGGCGGGCAGGGG - Intergenic
922833288 1:228614050-228614072 CCGGGGGAAGGGGCGGGCAGGGG - Intergenic
922833848 1:228616291-228616313 CCGGGGGAAGGGGCGGGCAGGGG - Intergenic
922834405 1:228618532-228618554 CCGGGGGAAGGGGCGGGCAGGGG - Intergenic
922834965 1:228620764-228620786 CCGGGGGAAGGGGCGGGCAGGGG - Intergenic
922835516 1:228622967-228622989 CCGGGGGAAGGGGCGGGCAGGGG - Intergenic
922836074 1:228625209-228625231 CCGGGGGAAGGGGCGGGCAGGGG - Intergenic
922836632 1:228627448-228627470 CCGGGGGAAGGGGCGGGCAGGGG - Intergenic
922837191 1:228629690-228629712 CCGGGGGAAGGGGCGGGCAGGGG - Intergenic
922837752 1:228631931-228631953 CCGGGGGAAGGGGCGGGCAGGGG - Intergenic
922838310 1:228634171-228634193 CCGGGGGAAGGGGCGGGCAGGGG - Intergenic
922838868 1:228636396-228636418 CCGGGGGAAGGGGCGGGCAGGGG - Intergenic
922839428 1:228638637-228638659 CCGGGGGAAGGGGCGGGCAGGGG - Intergenic
922839989 1:228640868-228640890 CCGGGGGAAGGGGCGGGCAGGGG - Intergenic
922840549 1:228643109-228643131 CCGGGGGAAGGGGCGGGCAGGGG - Intergenic
922841112 1:228645340-228645362 CCGGGGGAAGGGGCGGGCAGGGG - Intergenic
922841657 1:228647561-228647583 CCGGGGGAAGGGGCGGGCAGGGG - Intergenic
923007846 1:230066857-230066879 ACGGGGGAGGGGGCGGCCGGCGG + Intronic
923008197 1:230068061-230068083 CCGGGGGCCGGGTTGGGCAGAGG - Intronic
923268534 1:232334828-232334850 GAGGAGGAAGGGGAGGGCAGGGG - Intergenic
923602066 1:235412149-235412171 AGGGGGGAAGGGGAGGGGAGGGG - Intronic
924199016 1:241640402-241640424 CGGGCGGAAGGGGCGGGAAGAGG - Intronic
924436553 1:244048601-244048623 GCGGGGGAGGGGGAGGGGAGGGG - Intergenic
924436879 1:244049448-244049470 CCGGGGGAGGGGGCCGGCGGGGG + Intronic
924823060 1:247513104-247513126 CTGGGGGAAGGGGCGGCTATGGG - Intronic
1063069956 10:2651466-2651488 CAGGGGGAAAGGGTGGGAAGGGG - Intergenic
1063081289 10:2770144-2770166 TCGGGGGAAGGGGTGGGAAGGGG + Intergenic
1063118464 10:3087410-3087432 CCGAGGGCAGGGGCAGGAAGAGG - Intronic
1063192190 10:3706218-3706240 CAGGGGGAAAGGGTGGGAAGGGG + Intergenic
1063470519 10:6280950-6280972 CAGGGGGAAAGGGTGGGAAGGGG - Intergenic
1064059667 10:12127552-12127574 CGGGGGGTGGGGGGGGGCAGGGG - Intergenic
1064728238 10:18302697-18302719 CAGGGGGAAAGGGTGGGAAGGGG + Intronic
1065742602 10:28810836-28810858 CTGGGGGCAGGAGCGGGGAGCGG + Intergenic
1065744989 10:28832187-28832209 CCTAGGGGAGGGGCGGGGAGTGG + Intergenic
1065949591 10:30639894-30639916 CAGGGGGAAAGGGTGGGAAGGGG + Intergenic
1065975808 10:30841447-30841469 CAGGGGCAAGGGAAGGGCAGAGG + Intronic
1065996669 10:31065674-31065696 CAGGGGGAAAGGGTGGGAAGGGG + Intergenic
1066000128 10:31096845-31096867 CAGGGGGAAAGGGTGGGAAGGGG + Intergenic
1066004457 10:31133960-31133982 GCGGGGGAGGGGGCGAGGAGGGG - Intergenic
1066370413 10:34814845-34814867 CCGGGGGCGCGGGCGGGGAGGGG - Intronic
1067085119 10:43234071-43234093 CCTGGGGAAGGGGCTGGAAGGGG + Intronic
1067184670 10:44016364-44016386 CAGGGGGTAGGGGTGGGGAGTGG + Intergenic
1067583532 10:47461663-47461685 CCGGGGAAAGGGGCCGTCCGGGG + Intronic
1067633535 10:47987011-47987033 CCGGGGAAAGGGGCCGTCCGGGG + Intergenic
1067947142 10:50696708-50696730 CCGGTGGAAGGTGCTGGAAGAGG - Intergenic
1068363140 10:56007074-56007096 CCGGGGGAAAGGATGGGAAGTGG - Intergenic
1068585427 10:58792842-58792864 CCAGGGGAGGGGGAGGGAAGGGG - Intronic
1068685917 10:59869823-59869845 TCGGGGCAAGAGGCAGGCAGAGG - Intronic
1068702327 10:60033269-60033291 CCGGGGGCAGGGGAGGGGGGCGG + Intronic
1068989034 10:63132539-63132561 CTGGGGCAGGGGGCGGGCAGAGG + Intergenic
1069037896 10:63664612-63664634 GCGGGGGGAGGGGCGGGGGGAGG + Intergenic
1069348266 10:67495509-67495531 CTGGAGGAATGGGCGGGTAGTGG + Intronic
1069560934 10:69428867-69428889 GCTGGGGTAGGGGTGGGCAGTGG + Intergenic
1069729324 10:70600835-70600857 CACGGGGCAGGGACGGGCAGGGG + Exonic
1069956806 10:72057031-72057053 CCCAGGGAGGGGGTGGGCAGGGG + Intergenic
1070659338 10:78293544-78293566 AAGGGGGAGGGGGTGGGCAGTGG - Intergenic
1070800545 10:79242549-79242571 CCGGGGGGAGGGGAGGGGAGGGG - Intronic
1070882453 10:79861696-79861718 CCGGTGGAAGGTGCTGGAAGAGG - Intergenic
1071434585 10:85635408-85635430 GAGGGGGCAGGGGAGGGCAGGGG - Intronic
1071649023 10:87378007-87378029 CCGGTGGAAGGTGCTGGAAGAGG - Intergenic
1072966815 10:99980921-99980943 CAGGGGGTAGGGGCGAGAAGAGG + Intronic
1073083473 10:100873975-100873997 CAGGGGGAGGGGGCAGGCAAAGG + Intergenic
1073321079 10:102616641-102616663 CCTGGGGGAGGGGCAGGCAGGGG - Intronic
1073349689 10:102810860-102810882 GGGAGGGAAGGGGAGGGCAGGGG - Intronic
1073392788 10:103193114-103193136 CCGGGGGCGGGGGCAGGCGGCGG + Intronic
1074105096 10:110383307-110383329 CTGGGGCAAGGGGCAGGCATAGG + Intergenic
1074491902 10:113945990-113946012 CCAGGGAAAGGGGCGGGCTCTGG + Intergenic
1074516295 10:114173828-114173850 GCGGAGGAAGGGGAGGGCTGGGG - Intronic
1074580848 10:114717927-114717949 GGGGGGGAAGGGGAGGGGAGGGG + Intergenic
1074761451 10:116670052-116670074 CCGCGGGAAGGGTGGGGGAGGGG - Intronic
1075112040 10:119596051-119596073 ACGGGGGAAGGGCCTGGCGGGGG - Intronic
1075349302 10:121709589-121709611 GCGTGGAAAGGGGAGGGCAGTGG - Intergenic
1075447449 10:122523521-122523543 CTGGGGGTTGGGGCAGGCAGGGG + Intergenic
1075782609 10:125026847-125026869 GCGGGCGGAGGGGCTGGCAGAGG - Exonic
1075960246 10:126562270-126562292 CAGGGGGTAAGGGAGGGCAGGGG - Intronic
1076298653 10:129406917-129406939 CAGGGGGAAAGGGTGGGAAGGGG + Intergenic
1076372595 10:129964803-129964825 CCGGAGGGAGGAGCGGGCAACGG + Intergenic
1076471780 10:130724059-130724081 CCGGGGAAAGGTGCAGGCAGTGG + Intergenic
1076571656 10:131437284-131437306 TTGGGGGAAGGGGTGGGCTGGGG - Intergenic
1076612995 10:131737982-131738004 CCTGGGGAAAGGACGGGCTGGGG + Intergenic
1076695081 10:132243422-132243444 CCGGGTAAGGGGGCAGGCAGGGG + Intronic
1076871907 10:133198607-133198629 CCGAGGAGAGGGGCGGCCAGAGG + Exonic
1076873782 10:133206280-133206302 CTGGGGGCAGGGGGTGGCAGCGG - Intronic
1076909197 10:133379054-133379076 GCGCGGGGAGGGGCGGGGAGGGG - Intergenic
1076909251 10:133379164-133379186 GCGCGGGGAGGGGCGGGGAGGGG - Intergenic
1076915923 10:133423173-133423195 CTGGGGGATGGCGCGGGCCGGGG + Exonic
1077026168 11:441007-441029 TGGGAGGAAGGGGCTGGCAGAGG + Intronic
1077095064 11:795740-795762 GGGGAGGAAGGGGCGGGCAAGGG - Intronic
1077219476 11:1409274-1409296 CAGGGAGAAGAGGCGGGCACGGG - Intronic
1077384264 11:2261600-2261622 CAGGAGGAGGGGGTGGGCAGAGG + Intergenic
1077386138 11:2270372-2270394 CCGCAGGAAGGTGCAGGCAGAGG + Exonic
1077404655 11:2377628-2377650 CCGGGGGCCGGGGCGGGAGGGGG + Intronic
1077538768 11:3136681-3136703 CCTGGGGAAGGCGCCTGCAGAGG + Intronic
1077923074 11:6655825-6655847 GCGGGGGGAGGGGAGGGGAGGGG - Exonic
1077923120 11:6655922-6655944 CCGGGGGGAAGGGGGGGCGGCGG - Intergenic
1078017149 11:7624578-7624600 CATGGGGAAGGGGTGGCCAGAGG + Intronic
1078922319 11:15842076-15842098 CCTGGGGAAGGGTTGGGCAGAGG + Intergenic
1079043305 11:17078310-17078332 CGGGGAGAAGGGTTGGGCAGAGG + Intronic
1079366471 11:19814373-19814395 CCAGGGGAGGGAGAGGGCAGTGG - Intronic
1079601417 11:22316328-22316350 GCGGGGGGAGAGACGGGCAGGGG - Intergenic
1080036557 11:27718562-27718584 GGGAGGGGAGGGGCGGGCAGGGG - Intronic
1080657080 11:34266615-34266637 TCGGAGGAAGGGGGTGGCAGGGG - Intronic
1080779110 11:35414523-35414545 GCGGGGTGAGGGGCGGGCAGAGG + Intronic
1080779677 11:35419078-35419100 GCGGGTGGAAGGGCGGGCAGAGG - Exonic
1080878904 11:36301174-36301196 CCGGGGTCAAGGGAGGGCAGGGG + Intronic
1081793641 11:45805330-45805352 TGGGAGGGAGGGGCGGGCAGGGG - Exonic
1081851033 11:46275460-46275482 CCTGGGGAAAGGGGTGGCAGGGG - Intergenic
1081851504 11:46277967-46277989 CCCGGGGGAGGGGCGGACGGAGG - Exonic
1081995297 11:47359823-47359845 CTGGGGGACGGGGCAGGCGGTGG + Intronic
1082076603 11:47980421-47980443 GCGGGGGCAGCGGCGGGCGGCGG + Intergenic
1082210512 11:49495968-49495990 TTGGGGGAGGGGGTGGGCAGGGG - Intergenic
1083039027 11:59668771-59668793 GCGGGGCAGGGGGCGGGCTGGGG - Intronic
1083271639 11:61575884-61575906 CGGGTGGAAGGGGAGGGCGGAGG - Intronic
1083573197 11:63770794-63770816 GGGTGGGAAGGGGAGGGCAGAGG - Intergenic
1083609670 11:63998913-63998935 ACCGGGGCAGGGGCGGGCCGTGG + Intronic
1083666300 11:64276694-64276716 CTGGGGGAAGGAGAGGGCTGGGG + Intronic
1083784186 11:64934348-64934370 CAGGGGGAGGGGGAGGGCACAGG + Exonic
1083840511 11:65301703-65301725 CTGGGGGCAGGGGAGGGAAGAGG + Intronic
1083883449 11:65559166-65559188 CCCAGGGCAGGGGCTGGCAGCGG + Intergenic
1083940605 11:65893392-65893414 CGGGGGGAGAGGGGGGGCAGTGG + Intronic
1084178953 11:67437195-67437217 CCGGGGGCTGGGGGGGGCTGGGG + Intronic
1084220421 11:67674400-67674422 CAGGGGTGAGGGGCGGGCAGAGG - Intronic
1084515171 11:69634096-69634118 CAGGAGTAAGGGGTGGGCAGGGG - Intergenic
1084786975 11:71448238-71448260 CCAGGGGAAGGTGTGCGCAGTGG - Intronic
1085295379 11:75428739-75428761 CCGGGGGATCGGGTGGGCGGGGG - Intronic
1085460092 11:76688359-76688381 CCGGGCCAAGGGGCAGGCACTGG + Intergenic
1086093736 11:83030032-83030054 CCTGGGGAAGGAGTGGGCAAGGG + Intronic
1087117793 11:94543805-94543827 CCGGGGGAACGTGCGAGCAGAGG - Intergenic
1087172692 11:95067096-95067118 CCGGGCGGAGAGGCGGGCGGCGG - Intergenic
1087293483 11:96343333-96343355 CCGGGGAAAGGGGAACGCAGAGG + Intergenic
1088400928 11:109422374-109422396 CCGGGGGCAGGGGCGGGGGCTGG - Intronic
1088884884 11:113998856-113998878 CCTGGGGGAGGGGAGGGCAGAGG - Intergenic
1089186146 11:116615896-116615918 CAGGGGGAAGGGGATGACAGTGG + Intergenic
1089298543 11:117484022-117484044 CGGGGGGCAGGGGCGGGGGGCGG - Intronic
1089363079 11:117903899-117903921 CCTGGGGATGGGGGAGGCAGGGG - Intronic
1089641150 11:119848028-119848050 GCAGGAGAAGGGGAGGGCAGAGG - Intergenic
1089837950 11:121388114-121388136 CAGGGGGAAAGGGTGGGAAGTGG + Intergenic
1090233716 11:125129797-125129819 CCCAGGAGAGGGGCGGGCAGAGG + Intergenic
1090264001 11:125342768-125342790 TCTGGGGGAGGGGCGGGCCGGGG + Intronic
1090788401 11:130069688-130069710 CCGGGGGCGGGGCCGGGCGGGGG + Intergenic
1091692338 12:2605653-2605675 CAGTGGGAAGGGACGGGGAGAGG - Intronic
1091746849 12:2998349-2998371 CCTGGGGAAGCGCCGGGCTGTGG + Intronic
1091792699 12:3280848-3280870 CCCTGGGGAGGGGCCGGCAGGGG + Intronic
1092149281 12:6236087-6236109 CCGGGAGAACTGGTGGGCAGAGG - Intronic
1092162587 12:6324232-6324254 TCGGGGGAATGGGCGGGATGGGG - Intronic
1092183831 12:6464158-6464180 CCAAGGGAAGGGGCAGGGAGGGG - Exonic
1092185462 12:6475501-6475523 ACGGGGTCACGGGCGGGCAGAGG + Intergenic
1092238020 12:6821910-6821932 ACAGGGGACGGGGCAGGCAGGGG - Intronic
1092246573 12:6867437-6867459 CCGGGGGACTGGGCGGGCCATGG + Exonic
1092248686 12:6879065-6879087 CAGGGGGAAAGGGTGGGAAGAGG + Intronic
1092284596 12:7121500-7121522 CCGAGGGGAGAGGTGGGCAGTGG + Intergenic
1092388327 12:8052917-8052939 CGGGGGGAAGGGACGGGCTGGGG - Exonic
1092502603 12:9064335-9064357 CAGCAGGGAGGGGCGGGCAGCGG + Intergenic
1093464847 12:19439381-19439403 GCGGGGGCGGGGGCGGGCACTGG + Intronic
1093685074 12:22046172-22046194 GCGGGGGAGGGGGCGGGGCGAGG + Exonic
1094818203 12:34206154-34206176 CCTGGGGAAGGGGCGGGCAGGGG + Intergenic
1095098718 12:38161121-38161143 CCTGGGGAAGTTGCAGGCAGGGG - Intergenic
1095099134 12:38163076-38163098 CCAGGGGAAGTGGCGGCCAGGGG - Intergenic
1095133262 12:38568121-38568143 CTGGGGGAAGGTGGGGGTAGGGG - Intergenic
1095230329 12:39731746-39731768 CTGGGGGAAGGGGCGGCTATAGG - Intronic
1095818384 12:46450004-46450026 CCGGGGGGAGGGGGTGGCAGAGG - Intergenic
1095940647 12:47724723-47724745 CCAGGGGATGGGACTGGCAGAGG - Intronic
1095983147 12:47984033-47984055 CTGGGGGCAGGGGCTGGGAGGGG - Intronic
1096059251 12:48682438-48682460 CCGGGGAAGGGGGCGGAGAGCGG + Intergenic
1096191312 12:49622157-49622179 CCGGGGGAAGGTGGGAGCGGTGG + Intronic
1096489999 12:52007928-52007950 CCAGAGGAAGAGGCTGGCAGAGG - Intronic
1096658275 12:53105209-53105231 CCTGGGGGAGGTGGGGGCAGAGG - Exonic
1096674389 12:53218799-53218821 GGGTGGGAAGGGGCGGGCAGCGG - Intronic
1096700638 12:53380534-53380556 CCCGTGGCCGGGGCGGGCAGGGG - Intronic
1096837338 12:54359132-54359154 CGGCGGGAAGGGGAGGGGAGGGG + Intergenic
1096848487 12:54420570-54420592 CTTGGGGAAGAGGTGGGCAGGGG - Intergenic
1097264187 12:57736451-57736473 TCTGGGGAGGGGGTGGGCAGTGG + Intronic
1097265884 12:57744714-57744736 ACGGCGGGAGGGGCGGGTAGGGG - Intronic
1097267637 12:57755284-57755306 CCAGGGCAGGGGGCGGGGAGGGG - Exonic
1097765135 12:63517834-63517856 CAGGGGGAAAGGGTGGGAAGGGG + Intergenic
1098261531 12:68676631-68676653 CCTGAGGAAGGGGAGGGGAGGGG + Intergenic
1098943126 12:76559815-76559837 CCGGGGGGCGGGCGGGGCAGGGG - Intergenic
1098952863 12:76659779-76659801 CAGGGGGAAAGGGTGGGAAGAGG + Intergenic
1099576966 12:84393941-84393963 CCGGGGGGGGGGGGGGGCGGCGG - Intergenic
1100000144 12:89823858-89823880 TTGGGGGGGGGGGCGGGCAGGGG + Intergenic
1100826979 12:98483730-98483752 GAGGGGGAAGGGGAGGGGAGGGG + Intergenic
1100970954 12:100069702-100069724 CAGGGGGAAAGGGTGGGAAGGGG + Intronic
1101195909 12:102382004-102382026 CAGGGGGAAAGGGTGGGAAGGGG - Intergenic
1101819481 12:108172985-108173007 GAGGGGGAAGGGGCGGGGAGTGG - Intronic
1102217020 12:111168941-111168963 TGGGGGGAGGGGGCAGGCAGGGG - Intronic
1102570255 12:113823119-113823141 CTGGGGGGCGGGGCGGGGAGCGG - Intronic
1102687620 12:114736604-114736626 GCGGGGGAGGAGGAGGGCAGTGG - Intergenic
1102950749 12:117029452-117029474 CCAGGGGATGGGGCTGGGAGGGG + Intronic
1103074285 12:117969353-117969375 CTGGGCGAGGGGGCGGGGAGAGG + Intergenic
1103400535 12:120640542-120640564 GCGGGGCAAGGGGCGGGGCGCGG + Exonic
1103410794 12:120710379-120710401 GGCGGGGAAGGGGCGGGGAGGGG - Intergenic
1103779313 12:123388903-123388925 CCCGGGGAGGGGGCTGGTAGGGG - Intronic
1103859017 12:123996905-123996927 CCTGGGGAAGGGGTGAGCAGTGG - Intronic
1103993851 12:124816598-124816620 TCCAGGGATGGGGCGGGCAGAGG - Intronic
1103999409 12:124850877-124850899 TCGGGGGAAGAGGCGGCCATAGG - Intronic
1104038067 12:125112232-125112254 CCTGGGGAAGGGAAGGGAAGGGG + Intronic
1105308347 13:19184514-19184536 CCTGAGGAAGGGGAGGGCTGTGG - Intronic
1105413883 13:20192974-20192996 CCGAGGGAAGAGGCGGGGTGTGG - Intergenic
1105830598 13:24160656-24160678 CGGGGGGAAGAGCCGGGCTGGGG + Intronic
1105896101 13:24718497-24718519 CCCGGGGAAGAGGCCGGCTGGGG + Intergenic
1106042194 13:26103797-26103819 CCTGGGGAAGGGGCGGCTATGGG + Intergenic
1106189893 13:27442494-27442516 CCAGGGGAGGGTGTGGGCAGAGG - Intronic
1106351465 13:28934954-28934976 CGGGTGGAAAGGGCTGGCAGGGG - Intronic
1106498816 13:30307565-30307587 CCGGGGGGAGGGAGGTGCAGCGG + Intergenic
1106510476 13:30408517-30408539 GAGGAGGAGGGGGCGGGCAGGGG + Intergenic
1107251801 13:38372622-38372644 CCAGGGGAAAGGGTGGGAAGGGG + Intergenic
1107603925 13:42040503-42040525 CGGGGGGGAGGGGCGGGTAGCGG + Intronic
1108030032 13:46220201-46220223 CTGGGGGAAGAGGCGGCCATGGG - Intronic
1108313964 13:49220421-49220443 CCAGGGGAAAGGGCGAGCAGCGG - Exonic
1108409689 13:50133625-50133647 CCGGAGCAAGGGGCGCGCAGGGG + Intronic
1109154972 13:58898010-58898032 CCTGGGGAAGGGGCTTACAGAGG + Intergenic
1109747700 13:66647933-66647955 CCTGGGGAAGAGACGGCCAGGGG + Intronic
1111429665 13:88135044-88135066 GCGGGGGAAGTGGAGGGAAGGGG - Intergenic
1112081808 13:95980447-95980469 TCGGGGGAAAGGGCGGGGGGTGG + Intronic
1112802815 13:103131556-103131578 CCGGGGGATGGGGGTGGCGGGGG - Intergenic
1113114678 13:106862705-106862727 CAAGGGGAAAGGGCGGGAAGGGG + Intergenic
1113221170 13:108104112-108104134 GCGGGGGAAGGTGGGGGAAGGGG + Intergenic
1113380008 13:109795664-109795686 CCTGGGGAAGGGACGGGTTGGGG + Intergenic
1113386665 13:109855058-109855080 CAGGGGGAAAGAGCGGGAAGGGG + Intergenic
1113743374 13:112725940-112725962 GCTGGGGAGGGGGCGGGAAGCGG + Intronic
1113767495 13:112890228-112890250 CTGGGGGAAGGAGCGGGCTGTGG + Intergenic
1113768298 13:112894246-112894268 CCGGGGGCGGGGGCGGGGCGGGG - Intergenic
1113794801 13:113050767-113050789 CGGGGGGAGGGGGGCGGCAGGGG + Intronic
1113849634 13:113410743-113410765 CGTGGGGATGGGGAGGGCAGAGG + Intergenic
1115119961 14:29927520-29927542 CGGGGCGCAGGGCCGGGCAGCGG + Exonic
1115120069 14:29927872-29927894 GCGGGGGCCGGGGCGGGAAGGGG + Intronic
1115207486 14:30925221-30925243 TGGGGGGAGGGGGCGGGCAGGGG + Intronic
1115350181 14:32385556-32385578 TCGGGGGAAAGGGTGGGAAGGGG - Intronic
1116657982 14:47675015-47675037 CCGGCGGCGGGCGCGGGCAGGGG + Intergenic
1116846351 14:49868141-49868163 CCGGCGGAAGCGTCGGGGAGAGG + Intergenic
1117133288 14:52707145-52707167 GCGGGGGAAGGGGCGGGGCGAGG - Intergenic
1117478136 14:56118210-56118232 CCGGGGGAGGGGGCGCCCCGCGG + Intronic
1117721993 14:58637760-58637782 GCGGGGGAGGAGGCGGGGAGGGG + Intronic
1118350991 14:64972350-64972372 GCAGGGGAAGGGGCGGGCAGGGG - Intronic
1118607495 14:67514741-67514763 CAGGGGGAAGCGAGGGGCAGCGG - Intronic
1118797196 14:69153577-69153599 GTGGGGGAAGGTGCGGGCGGGGG + Intergenic
1118809010 14:69260394-69260416 CCGGCGGCCGGGGCGCGCAGAGG + Exonic
1119137769 14:72236670-72236692 ACGGTGGAGGGGCCGGGCAGAGG + Intronic
1119205514 14:72791015-72791037 CAGCAGGAAGGGGCGGGGAGAGG - Intronic
1119223384 14:72926643-72926665 CCAGGGAAAGGGGCGGGGAGGGG + Intronic
1119522321 14:75295089-75295111 CCGGGCGAGGGGGAGGGTAGGGG + Intergenic
1119544933 14:75464766-75464788 CCCGGGGAAGGGGCAGGCCTTGG + Intronic
1119895444 14:78215763-78215785 CAGGGGGGTGGGGGGGGCAGGGG + Intergenic
1119936375 14:78595836-78595858 CCTGGGAAAGGGGGTGGCAGAGG + Intronic
1120867046 14:89304297-89304319 GCCCGGGAAGGGGCGGGAAGGGG + Intronic
1121247456 14:92472396-92472418 TCGGGGGAAAGGGTGGGAAGGGG - Intronic
1121330500 14:93046587-93046609 CCGGGGGCGGGGGGGGGCGGCGG + Intronic
1121343102 14:93116360-93116382 AGGGGGGAAGGGGCGGGGACTGG + Intergenic
1121415914 14:93779227-93779249 GCGGGGGAGGGGGCCGGCACTGG + Exonic
1121710993 14:96039244-96039266 CCCGGGGGTGGGGCGGGGAGTGG + Intergenic
1121826850 14:97017248-97017270 CTGGGGGCAGGGGTGGGAAGGGG - Intergenic
1122025079 14:98869871-98869893 CAGGGGGAAAGGGTGGGAAGGGG + Intergenic
1122204470 14:100141695-100141717 CCAGGTGAAGGGACAGGCAGTGG - Intronic
1122270696 14:100567474-100567496 CCGGGGGCTGGGGCGGGTGGTGG + Intronic
1122286303 14:100654831-100654853 CGGGGGGCAGGGTCGGGCGGGGG - Intergenic
1122347147 14:101067615-101067637 CCAAGGGAAGGGGCCTGCAGAGG - Intergenic
1122444694 14:101760778-101760800 CCGAGGGAAGGGGCCGGCCGAGG + Intergenic
1122444756 14:101760914-101760936 CCGAGGGGAGGGGCTGGCCGAGG + Intergenic
1122444765 14:101760931-101760953 CCGAGGGAAGAGGAGGGGAGGGG + Intergenic
1122444793 14:101761000-101761022 TCGAGAGAAGGGGAGGGCAGGGG + Intergenic
1122515397 14:102304929-102304951 CCGGGGAAAGGGGCAGGGACTGG - Intronic
1122840766 14:104461607-104461629 ACGGGGGACGGGGCGGGGCGGGG + Intergenic
1122889016 14:104724157-104724179 GCGGGGCAGGGGGCGGGCCGGGG - Intergenic
1122972488 14:105158079-105158101 CCGGGGGGAGAGGTGGGCAAAGG + Intronic
1123004586 14:105315100-105315122 GCCGGGGATGGGGCGCGCAGAGG - Exonic
1123044665 14:105505482-105505504 CTGGAGGGAGGGGCTGGCAGTGG - Intergenic
1123047737 14:105526912-105526934 CCGGGAGGAGGGGCGGGAGGGGG - Intronic
1202853518 14_GL000225v1_random:36404-36426 CCCGGGGATGGGGCCGGCAAAGG + Intergenic
1123460454 15:20465497-20465519 TGGGTGGAAGGGGTGGGCAGGGG + Intergenic
1123657608 15:22534920-22534942 TGGGTGGAAGGGGTGGGCAGGGG - Intergenic
1124174907 15:27415527-27415549 CCGGGGGAAAGGGTGGGAGGGGG + Intronic
1124311518 15:28630117-28630139 TGGGTGGAAGGGGTGGGCAGGGG - Intergenic
1124365532 15:29068626-29068648 CCAGGAGAAGGGGCTGTCAGTGG + Intronic
1124389579 15:29242167-29242189 CCGGGGGCAGGGGGACGCAGGGG - Intronic
1124554365 15:30711280-30711302 CCGGGGGAAGGGGGGTTGAGGGG + Intronic
1126295181 15:47131712-47131734 CAGGGGGAGGGGGAGGGGAGGGG - Intergenic
1127071339 15:55290299-55290321 CCGGGGGCAGGGCCGGGCCTGGG - Intronic
1127195174 15:56576457-56576479 CAGGGGGAAAGGGTGGGAAGGGG + Intergenic
1127392867 15:58521165-58521187 CAGGGGGAAGGGGAGAACAGAGG - Intronic
1127922484 15:63504442-63504464 CCCGGGGGCGGGGCGGGGAGGGG + Intergenic
1128067874 15:64775634-64775656 CCGGGGGAGGGGGCGGGCGCCGG + Intergenic
1128145944 15:65332651-65332673 CCGGGGGAAAGGGTGGGAAGTGG - Intronic
1128279988 15:66386884-66386906 CCGGGGGAGGGGCGGGGAAGGGG - Exonic
1128326945 15:66729905-66729927 CCCGCAGAAGGGGCGGGGAGGGG + Intronic
1128384580 15:67138337-67138359 CCGGGGGAGGGGGGGTTCAGGGG - Intronic
1128454982 15:67827170-67827192 CCGGGGGCAGGGGCGGGCCCGGG + Intronic
1128636739 15:69307453-69307475 CAGAGGGAAGGGGAGGGGAGAGG + Intronic
1128967776 15:72077644-72077666 GCGGGGGGCGGCGCGGGCAGAGG + Intronic
1129245510 15:74276592-74276614 CCAGGGGAAGGGCTAGGCAGGGG - Intronic
1129274087 15:74434015-74434037 GCGGGGGGAGGGGCGGGGTGGGG - Exonic
1129483032 15:75843134-75843156 CCGGGGGCGGGGGCGCGCGGGGG + Intergenic
1129657150 15:77531849-77531871 CAGGGAGAAGAGGCAGGCAGAGG - Intergenic
1129705555 15:77792199-77792221 CCTGGGAATGGGGCGGGCACTGG - Intronic
1130076433 15:80694787-80694809 CCAGGGGGAGGGGAGGGGAGCGG + Intronic
1130321481 15:82846127-82846149 CTCCAGGAAGGGGCGGGCAGTGG + Intronic
1130990937 15:88875238-88875260 CCGGGGGCGGGGGTGGGGAGGGG - Exonic
1131053434 15:89362425-89362447 CGGGGTGAAGGGGGGGGCGGGGG + Intergenic
1132523178 16:400877-400899 CCCGGGGAAGGGGCAGAGAGGGG + Intronic
1132607637 16:800220-800242 CCGGGGATGGGGGCGGGTAGGGG - Intronic
1132618411 16:853272-853294 CAGGGGGAAGGGGTGGGTGGGGG + Intergenic
1132643842 16:989851-989873 CTGGGGGAAGGGAAGGGAAGGGG + Intergenic
1132683953 16:1154445-1154467 GCGGGGGAGGGGGAGGCCAGAGG + Intronic
1132693035 16:1190135-1190157 GCCAGGGAAGGGCCGGGCAGTGG - Intronic
1132713395 16:1279040-1279062 CTGGGGGAGGGGGTGGTCAGTGG + Intergenic
1132717892 16:1301248-1301270 GCCCGGGAGGGGGCGGGCAGAGG - Intergenic
1132750180 16:1453990-1454012 CAGAGGGAAGGGGACGGCAGGGG + Intronic
1132883811 16:2173687-2173709 CCTGGGCCAGGGGTGGGCAGGGG - Intronic
1132886916 16:2186411-2186433 CCTGGGGCAGGAGAGGGCAGGGG - Intronic
1132889449 16:2196643-2196665 CCGGGGGCGGGGGCGCGCGGCGG + Intergenic
1132987861 16:2777324-2777346 CCGGGGGAAGGGACGCGGCGCGG - Intergenic
1133020141 16:2963554-2963576 CCCAGGGAAGGGCGGGGCAGGGG + Intergenic
1133050708 16:3115823-3115845 CCGGGGGGAGGGGAGGGCTGTGG - Exonic
1133109095 16:3535035-3535057 CGGGAGGAAGGGGCAGGCAGAGG + Intronic
1133204024 16:4222123-4222145 CTGGGGGAAGGGAGTGGCAGTGG - Intronic
1133259431 16:4538566-4538588 CCGCGGGCGGGGGCGGGGAGGGG + Intronic
1133267540 16:4594013-4594035 CCGTGGGAAGGGGAGGGACGTGG + Intronic
1133315564 16:4881642-4881664 CCGGGCCAAAGGGCGGACAGAGG - Exonic
1133332289 16:4982203-4982225 GCGGGGGGAGGGGGGGGCCGAGG - Intronic
1134523562 16:14928949-14928971 CAGGGGGAAGGGAGGGGAAGGGG - Intronic
1134562289 16:15220998-15221020 CTGGGGGAGGGTGTGGGCAGAGG - Intergenic
1134566726 16:15258056-15258078 GCGGGGGCAGGAGGGGGCAGGGG - Intergenic
1134735767 16:16498643-16498665 GCGGGGGCAGGAGGGGGCAGGGG + Intergenic
1134750329 16:16619871-16619893 GAGGGGGAGGGGGAGGGCAGGGG + Intergenic
1134922828 16:18132624-18132646 CTGGGGGAGGGTGTGGGCAGAGG - Intergenic
1134931759 16:18213579-18213601 GCGGGGGCAGGAGGGGGCAGGGG - Intergenic
1135302879 16:21345860-21345882 GCGGGGGAAGGGACGGGGAGGGG - Intergenic
1135423921 16:22322967-22322989 GCGTGGGAAGAGGGGGGCAGCGG + Intronic
1135617078 16:23920716-23920738 CCAGGGGAAGGGGATGGAAGGGG + Intronic
1135917385 16:26617198-26617220 CAGGGGGAAAGGGTGGGAAGGGG - Intergenic
1136033317 16:27519234-27519256 ACTGGGGAAGGGGAGGGGAGAGG + Intronic
1136041365 16:27581737-27581759 CAGGGGGAAAGGGTGGGAAGGGG - Intronic
1136402966 16:30028473-30028495 GGGAGGGAAGGGGTGGGCAGAGG + Intronic
1136458420 16:30395409-30395431 CCGGGGGCGGGGACGGGAAGCGG - Exonic
1136556034 16:31008402-31008424 GCGGGGTAAGGGGGAGGCAGGGG - Intronic
1136704858 16:32178675-32178697 TGGGTGGAAGGGGTGGGCAGGGG + Intergenic
1136709966 16:32228924-32228946 CGGGGGGCAGGGGCGGGCGCAGG + Intergenic
1136757943 16:32700487-32700509 CGGGGGGCAGGGGCGGGCGCAGG - Intergenic
1136763057 16:32750732-32750754 TGGGTGGAAGGGGTGGGCAGGGG - Intergenic
1136805043 16:33119654-33119676 TGGGTGGAAGGGGTGGGCAGGGG + Intergenic
1136810163 16:33169888-33169910 CGGGGGGCAGGGGCGGGCGCAGG + Intergenic
1136816639 16:33279968-33279990 CGGGGGGCAGGGGCGGGCGCAGG + Intronic
1137401351 16:48156417-48156439 GCAGGGGTAGGGGAGGGCAGGGG + Intergenic
1137401359 16:48156433-48156455 GCAGGGGTAGGGGAGGGCAGGGG + Intergenic
1137569655 16:49557329-49557351 CGGGGAGGAGGAGCGGGCAGGGG - Intronic
1137609696 16:49810241-49810263 TGGGGGCAAGGGGCTGGCAGAGG - Intronic
1137617138 16:49855116-49855138 CCGGGAGAAGGCCTGGGCAGGGG + Intronic
1137949879 16:52773562-52773584 CGGGGGGAAGGGGTGGGAAAGGG + Intergenic
1138538147 16:57670934-57670956 CTGGGGGCTGAGGCGGGCAGGGG - Intronic
1138590297 16:57995989-57996011 CCTGGGGACTGGGAGGGCAGAGG - Exonic
1138695585 16:58810010-58810032 TCGGGGGAAAGGGTGGGAAGGGG + Intergenic
1138889856 16:61128862-61128884 AAGGGGGAAGGGGAGCGCAGGGG + Intergenic
1139364977 16:66427455-66427477 CGCGGGGGAGGGGCGGGCGGGGG + Intronic
1139489527 16:67279108-67279130 CCGCGGGACGGGGCGGGGCGGGG - Exonic
1139511560 16:67431058-67431080 GCGGGGGAGAGGGCGGGGAGCGG - Intronic
1139576786 16:67847079-67847101 CCGGGGGGGGGGGAGGGGAGGGG - Intronic
1139632016 16:68236643-68236665 CCTGGGAAAGGGGAGGGCGGCGG + Intronic
1139896229 16:70289752-70289774 CCGGGGGCGGGGGGGGGCGGGGG - Intronic
1140408164 16:74724828-74724850 TGGGGTGAGGGGGCGGGCAGAGG - Intronic
1141054592 16:80803949-80803971 CCGCGGGAGGCGGCGGGCGGCGG + Intronic
1141086064 16:81096326-81096348 CCGGGAGGCGGGGCGGGGAGGGG + Exonic
1141125818 16:81400273-81400295 GTGGGGAAAGGGGTGGGCAGGGG - Intergenic
1141132466 16:81445212-81445234 CCGGGGGAGGGGGCTGGGGGCGG - Exonic
1141168544 16:81676800-81676822 CTGGGGGAAGGGGTGGGAGGGGG - Intronic
1141608537 16:85169133-85169155 CGGGCGGGAGGGGCGGGGAGGGG - Intergenic
1141615289 16:85206663-85206685 GCCGGGGAGGGGACGGGCAGGGG - Intergenic
1141625554 16:85259334-85259356 CGGAGGGAAGGGGCGAGCACAGG - Intergenic
1141662482 16:85448959-85448981 GCGGGTGGAGGGGCGGGGAGAGG - Intergenic
1142049911 16:87951544-87951566 CCGCGGGAAGGGGGAGGCGGAGG - Intronic
1142051266 16:87959757-87959779 CCGGGTGAGGGGGTGGGCTGAGG + Intronic
1142061338 16:88031811-88031833 GCGGGGGAAGGGACGGGGAGGGG - Intronic
1142126080 16:88411360-88411382 CCAGGGGGAGTGGCGGGCAGGGG + Intergenic
1142200114 16:88757124-88757146 CCTGGGGAAGGGAAGGGCTGAGG + Intronic
1142240084 16:88941031-88941053 CCGGGGGATCCGGCGGGCGGCGG + Intronic
1203060094 16_KI270728v1_random:960836-960858 CGGGGGGCAGGGGCGGGCGCAGG - Intergenic
1203065208 16_KI270728v1_random:1011055-1011077 TGGGTGGAAGGGGTGGGCAGGGG - Intergenic
1203081431 16_KI270728v1_random:1147723-1147745 CCGGGGGACGGGGCGGCGGGAGG + Intergenic
1142518626 17:489877-489899 CGGGGGGCAGGGCCGGGCTGCGG + Intergenic
1142553008 17:752417-752439 CCGGAAGAGGGGCCGGGCAGGGG - Intronic
1142560464 17:806266-806288 CCTGGGGAAGGGGGGAGCTGGGG - Intronic
1142560482 17:806311-806333 CCTGGGGAAGGGGGGAGCTGGGG - Intronic
1142586964 17:979824-979846 GCGGGGGAAGGGGCGTGGCGCGG - Intergenic
1142610735 17:1108287-1108309 CCGGTGGAACTGGAGGGCAGTGG - Intronic
1142697768 17:1643267-1643289 CCGGTGGGCGGGGCGGGCACCGG - Intronic
1142752785 17:1998488-1998510 CCGGGGGCAGCCGCGGGGAGGGG - Intronic
1142781267 17:2182895-2182917 CAGGGGGGTGGGGTGGGCAGGGG + Intronic
1142836847 17:2593846-2593868 CCCGGGGAGGGGGAGGGGAGGGG - Exonic
1143174368 17:4947999-4948021 CCGGGGCACAGGGCGGGGAGGGG - Intronic
1143216598 17:5229818-5229840 ATGGGGGAAGGGGAGGGGAGGGG - Intronic
1143373765 17:6455647-6455669 CGGAGGGCAGGGGAGGGCAGGGG + Intronic
1143435000 17:6917468-6917490 CAGGGGGAAAGGGCGGGAAGAGG + Intronic
1143501845 17:7343838-7343860 CTGGGGGACAAGGCGGGCAGTGG - Intronic
1143634938 17:8159217-8159239 GTGGGGGAAGAGGGGGGCAGGGG + Exonic
1143741009 17:8954017-8954039 CTGGGGGAAGGGGAGAGCGGTGG - Intronic
1143749946 17:9021147-9021169 CCGGGGGAGCGCGCGGGCGGGGG - Intergenic
1143838494 17:9712062-9712084 CCTGGGGCAGGGAGGGGCAGGGG - Exonic
1143950536 17:10629172-10629194 CCGGGGGTGGGGGCGGCAAGGGG - Intronic
1144208234 17:12994135-12994157 CCAGGGGAAGGCGGGGGCTGGGG - Intronic
1144515899 17:15917542-15917564 GCGGGGGCAGGGCTGGGCAGGGG - Intergenic
1144559964 17:16312920-16312942 GAGGGGGAAGGGGGGGGGAGAGG + Intronic
1144767051 17:17738525-17738547 GCGGGTGAAGGCGGGGGCAGAGG + Intronic
1144851175 17:18244718-18244740 CCGGCGGGGGGGGGGGGCAGGGG + Exonic
1144968080 17:19090204-19090226 CCCGGGGCAGGTGCTGGCAGAGG + Intergenic
1144979837 17:19161859-19161881 CCCGGGGCAGGTGCTGGCAGAGG - Intergenic
1144988385 17:19216373-19216395 CCCGGGGCAGGTGCTGGCAGAGG + Intronic
1145207535 17:20992590-20992612 ACGTGGGCACGGGCGGGCAGGGG - Intergenic
1145398873 17:22515498-22515520 AGGAGGGAAGGGGAGGGCAGGGG + Intergenic
1145976514 17:28987079-28987101 CTGAGGGACAGGGCGGGCAGGGG + Intronic
1146194040 17:30795859-30795881 CCGGGGGAAGCGGCAGGCGGGGG + Intronic
1146260194 17:31415850-31415872 CCCCGGGAAGGGACAGGCAGAGG - Intronic
1146809318 17:35890722-35890744 GTGGGGGAAGGGGTGGGGAGAGG - Intergenic
1146812951 17:35918188-35918210 CCTGGCGAAGGGGAGGGAAGGGG - Exonic
1146979495 17:37146661-37146683 GGGGGGGAAGGGGGGGGCAGAGG + Intronic
1147033450 17:37660944-37660966 TAGGGGGAAGGGGTGGGAAGCGG - Intergenic
1147183691 17:38702496-38702518 ACGGGAGAAGGTGCGGGAAGCGG + Intergenic
1147184164 17:38704872-38704894 CCGGGGGAAGGGGCGCTAGGAGG - Intergenic
1147258217 17:39194667-39194689 CTGGGGGAGGGGCCGGGCAGGGG + Intronic
1147323854 17:39661111-39661133 CCCAGGGGAGGGGCTGGCAGGGG - Intronic
1147325533 17:39667862-39667884 CCTGGAGGAGGGGCGGGGAGGGG + Intergenic
1147382225 17:40062786-40062808 CGGGGGGCGGGGGCGGGCGGCGG + Intronic
1147402863 17:40191544-40191566 GCGGGGTCAGGGGCGGGCGGCGG - Intronic
1147452303 17:40513175-40513197 CCAGGGGAGGGGCTGGGCAGAGG + Intergenic
1147732049 17:42610084-42610106 TGGGGGGAAGGGGCGGGCAGGGG - Intronic
1147926976 17:43952449-43952471 CTGGAAGAAGGGGCGGGGAGCGG - Intergenic
1148111589 17:45147539-45147561 CCGGGGCCGGGGGCGGGCGGGGG - Intergenic
1148685888 17:49501105-49501127 CCAGGGGAAGGGGCTGGTGGAGG - Intronic
1148754296 17:49964614-49964636 CCGGGGGAGGAGGAGGGGAGAGG - Intergenic
1148852121 17:50560503-50560525 CAGGGGCAAGGGGAGGGGAGAGG + Intergenic
1148878594 17:50707788-50707810 CCCGGGGCGGGCGCGGGCAGCGG - Exonic
1149124243 17:53208622-53208644 CAGGGGGAAAGGGCGGGAAGAGG + Intergenic
1149413495 17:56433672-56433694 CAAGGGGAAAGGGCGGGAAGGGG + Intronic
1149430994 17:56595661-56595683 GCGTGGGAGGGGGCGGGTAGGGG + Intergenic
1149607509 17:57935582-57935604 CGGGAGGAAAGGGAGGGCAGCGG - Intronic
1150280241 17:63925872-63925894 TCTGGGGAGGGGGCAGGCAGAGG + Intergenic
1150624801 17:66835055-66835077 CGAGAGGGAGGGGCGGGCAGGGG - Intergenic
1150681817 17:67290726-67290748 CTGGGGGAAGGTGTGGGCTGTGG + Intergenic
1151163112 17:72182657-72182679 CATGGGGAAGTGGCTGGCAGTGG - Intergenic
1151344675 17:73494376-73494398 CCGGTGCAGGGGGCAGGCAGGGG - Intronic
1151386736 17:73759631-73759653 GCGGGGGAAGGGGCACGGAGCGG + Intergenic
1151433649 17:74081171-74081193 GCGGGAGACGGGGTGGGCAGCGG + Intergenic
1151540875 17:74764028-74764050 GTGGGGGATGGGGAGGGCAGGGG - Intronic
1151598979 17:75094796-75094818 CCAGGAGAAGGGGCAGACAGGGG - Intronic
1151703884 17:75756872-75756894 CCGGGGGCAGGAGTGGCCAGGGG + Intronic
1151828916 17:76538341-76538363 CCGGGGCGGTGGGCGGGCAGGGG - Intronic
1151933355 17:77247050-77247072 CCCGGGGAGGGGGCTCGCAGGGG + Intergenic
1151952846 17:77364687-77364709 CTGGGGGCAGAGACGGGCAGGGG + Intronic
1152132552 17:78485757-78485779 CCTGGGGCAGGGGAGGGAAGGGG + Exonic
1152197261 17:78925095-78925117 CCGGGGGGCTGGGCGGGCGGGGG + Exonic
1152197380 17:78925500-78925522 CTGGGGGGAGGCGCGGGCGGAGG - Intergenic
1152329006 17:79659824-79659846 TGGGGGGAAGGGGAGGGAAGAGG - Intergenic
1152342268 17:79731676-79731698 CCAGCTGGAGGGGCGGGCAGGGG - Intronic
1152349858 17:79778451-79778473 CCGGGCGAGGGGGCGGGAGGGGG - Intronic
1152355972 17:79807490-79807512 CAGGGGGCAGGGCAGGGCAGAGG + Intergenic
1152408642 17:80111129-80111151 GCGGGGAAAGGGGCGGGGGGGGG + Intergenic
1152608552 17:81304812-81304834 CCAGGAAAAGGGGAGGGCAGAGG - Intergenic
1152641027 17:81449294-81449316 CGGGGACAAGGGGAGGGCAGGGG - Intronic
1152654829 17:81514651-81514673 CCGCGGGGAGGGGCGGGGAGGGG + Intronic
1152677719 17:81650375-81650397 ATGGGGGAAGGGGTGGGCAGTGG - Intergenic
1152744169 17:82031572-82031594 GCGGGGGCGGGGGCGGGCGGGGG - Intergenic
1152745670 17:82037576-82037598 CGGCGGGCAGAGGCGGGCAGGGG - Intronic
1152790041 17:82273811-82273833 CCGGGGTAACAGGAGGGCAGAGG - Intergenic
1153262529 18:3238370-3238392 CTGGGGGAGGGGGGAGGCAGGGG + Intergenic
1153282319 18:3425956-3425978 GCGGGGGCAGGGCAGGGCAGGGG - Intronic
1153382263 18:4454067-4454089 CCGTGGGAAGGGGTGGCCCGTGG - Intronic
1154157014 18:11951701-11951723 GTGGGGGAAGGGGCTGGAAGAGG + Intergenic
1155007599 18:21741848-21741870 CGGGGGGAAGGGGCGAGCTGCGG + Intronic
1155084468 18:22443831-22443853 GCGGGGGAAGGCAGGGGCAGGGG + Intergenic
1155877000 18:31101271-31101293 CGGGGGGAAGTGGCGGGTGGGGG - Intronic
1156770003 18:40708718-40708740 CTAGGGGAAGGGGTGGGCAGGGG + Intergenic
1157304884 18:46509642-46509664 CCAGGGGAAGGGGTGGGTGGTGG + Intronic
1157435697 18:47667274-47667296 CCGGGGGCGGGGGCGGGGAAGGG + Intergenic
1157784505 18:50469712-50469734 CCGGGAGAAGCAGCAGGCAGAGG + Intergenic
1157968391 18:52236705-52236727 CCTGGTGGAGGGGTGGGCAGGGG + Intergenic
1158434784 18:57428145-57428167 CCGAGGGGAGGGGCGGGGAAGGG - Intergenic
1158436446 18:57437956-57437978 CCGCGGGAGGGGACGGGTAGAGG + Intronic
1158579864 18:58671701-58671723 CCGGCCGGAGGGGCGAGCAGCGG - Exonic
1158914149 18:62103426-62103448 CTGAGGGAAGGGGTAGGCAGTGG + Intronic
1159511252 18:69400830-69400852 CGGGGGGAGGGGGCGGGCCGGGG - Intergenic
1159540903 18:69774350-69774372 CAGGGGAAAAGGGCGGGAAGGGG + Intronic
1159798255 18:72868278-72868300 TCTGGGGGAGGGGCGGGGAGGGG + Intergenic
1159963887 18:74577598-74577620 CCTGGGGAAGGGGCCGAGAGGGG + Intronic
1160497339 18:79383228-79383250 CCGGGGCAGGGGGTGTGCAGGGG + Intergenic
1160690838 19:460303-460325 ACGTGGGGAGGGGCGGGGAGAGG - Intronic
1160717375 19:582433-582455 CTGGGGGCCGGGGTGGGCAGGGG + Intronic
1160773551 19:844328-844350 CAGGGGAGAGGGGCGGGCAAGGG - Intronic
1160773558 19:844345-844367 CAGGGGAGAGGCGCGGGCAGGGG - Intronic
1160773568 19:844377-844399 CAGGGGAGAGGGGCGGGCAAGGG - Intronic
1160773575 19:844394-844416 CAGGGGAGAGGCGCGGGCAGGGG - Intronic
1160773585 19:844426-844448 CGGGGGAGAGGCGCGGGCAGGGG - Intronic
1160773616 19:844509-844531 CAGGGGAGAGGGGCAGGCAGGGG - Intronic
1160773623 19:844526-844548 CCGGGCGGAGGCGCAGGCAGGGG - Intronic
1160857456 19:1223940-1223962 CAGCGGGAAGTGGTGGGCAGGGG + Intronic
1160873052 19:1285761-1285783 CCGGGGCAGGGGGCGGGCGCAGG + Intergenic
1160967298 19:1752383-1752405 CCCGGGGGTGGGGGGGGCAGAGG + Exonic
1161081125 19:2310653-2310675 AGGGGGAAAGGGGCGGGCAGAGG - Intronic
1161210354 19:3062415-3062437 CGGCGGGGAGGGGCGGGGAGGGG - Intronic
1161252172 19:3286064-3286086 CAGGTGGACAGGGCGGGCAGAGG - Intronic
1161264638 19:3358714-3358736 CCGTAGGAAGTGGGGGGCAGCGG - Intergenic
1161299612 19:3536491-3536513 CTGCGGGCAGGGGCGGGCATGGG - Intronic
1161333620 19:3699744-3699766 CTGGGGGAAGGCTCGGGGAGAGG + Intronic
1161406980 19:4096190-4096212 GCAGGGGCAGGGGCGGGAAGAGG + Intronic
1161484130 19:4525602-4525624 CCCGGAGCAGGGGCGGGCAGCGG + Intronic
1161733597 19:5977491-5977513 CGGGGGGAACTGGCGGGAAGTGG + Intronic
1162066954 19:8131639-8131661 GCCAGGGAAGGGGCGGGCACAGG + Exonic
1162296660 19:9818690-9818712 CGGGGGGAAGGGCAGGGCGGAGG - Intronic
1162318987 19:9959812-9959834 CCTGGGGAGGTGGGGGGCAGGGG + Exonic
1162506773 19:11090392-11090414 GCGGGGGCAGGGGCGGGAGGGGG - Intronic
1162549324 19:11349870-11349892 CTGGGGCAAGGGCAGGGCAGAGG - Intronic
1162582886 19:11541053-11541075 CTGGGGCGAGGGGAGGGCAGGGG - Intronic
1162588665 19:11577012-11577034 CAGGAGGTGGGGGCGGGCAGTGG - Intronic
1162725939 19:12689721-12689743 CCGGGGGGAGGGACAGTCAGGGG + Intronic
1162751706 19:12833719-12833741 CGGGGGGAAGGGGCGGGCGGGGG - Intronic
1162806628 19:13140635-13140657 TGGGGAGAAGGGTCGGGCAGGGG + Exonic
1162914178 19:13865460-13865482 CCGGGGGCACGGGCGGGGCGGGG + Intronic
1162952600 19:14080879-14080901 GCGGGGGGAGGGGAGGGGAGGGG + Intergenic
1162954602 19:14091033-14091055 CGGGGGAAAGCGGCGGGCGGGGG + Intronic
1162955867 19:14097546-14097568 TCAGGGGAAGGGGAGGGCTGGGG + Intronic
1163012248 19:14433469-14433491 GCGGAGGGAGGGGCGGCCAGAGG - Intronic
1163147169 19:15387957-15387979 CTGGGAGAGGGGGCGGGGAGGGG + Intronic
1163210619 19:15837083-15837105 CCGGGGGACGTGGCGGGCTGTGG - Intergenic
1163351327 19:16777862-16777884 AGGGGGGAAGGGGAGGGGAGAGG + Intronic
1163373282 19:16914544-16914566 CTGGGGGAAGTGGGGGGAAGTGG - Intronic
1163537227 19:17883778-17883800 GCGGGGCAAGGGGCGGGGAGGGG + Intronic
1163635015 19:18433647-18433669 CCGGGGGGGGTGGCGGGGAGGGG + Intronic
1163668462 19:18613850-18613872 CCTGGGGGAGGGGAGGACAGGGG - Exonic
1163722662 19:18905638-18905660 CAGGGCGAGGGGGCGGTCAGCGG + Intronic
1163785607 19:19273393-19273415 CCAGGGGGAGGGCCGGGGAGGGG - Intergenic
1164956632 19:32392196-32392218 ACGAGGGGAGGGGAGGGCAGGGG + Intergenic
1165058658 19:33194490-33194512 GCGGGGGCAGCGGCGGGCGGGGG + Intronic
1165062671 19:33212480-33212502 TCGGGGTAAGGGCCGGGCTGGGG - Intronic
1165098727 19:33425476-33425498 CAGGGGCAAGGGGAGGGAAGGGG + Intronic
1165114681 19:33521829-33521851 GCGGGGTAAGGGCGGGGCAGGGG + Intergenic
1165157644 19:33797603-33797625 CAGGGGGTGCGGGCGGGCAGCGG - Intronic
1165172364 19:33903168-33903190 GGGGGGGAAGGGGCGGGGCGGGG + Intergenic
1165313483 19:35041673-35041695 GCGGGTGAAGGGGCGGGGAGGGG - Intronic
1165349670 19:35269047-35269069 CGGGGGGGAGGGGAGGGGAGGGG - Exonic
1165373060 19:35422130-35422152 CTGGGGGAAGGGGCTGGATGGGG - Intergenic
1165950697 19:39472676-39472698 CATGGGGCAGGGGTGGGCAGAGG + Intronic
1165958461 19:39516052-39516074 CCCGGGGACAGGGCCGGCAGTGG + Intronic
1165987506 19:39783027-39783049 TCGGGGGAAAGGGTGGGAAGGGG - Intronic
1166047501 19:40238095-40238117 CAGGAGGAAGGGGTGGGGAGAGG + Intronic
1166134119 19:40765179-40765201 ACAGGGGAAGGGGCAGGCATGGG - Exonic
1166235360 19:41451792-41451814 CCGGGGGAAAGGGTGGGAAGGGG + Intergenic
1166304145 19:41928135-41928157 CCGGGGCGAGGGGCGGGGTGGGG + Intronic
1166334219 19:42095746-42095768 CCCGCGTAGGGGGCGGGCAGTGG - Intronic
1166375376 19:42324530-42324552 CATGGGGCAGGGGCGGGCAGGGG - Intronic
1166394463 19:42428661-42428683 CCTGGGTAAGGGGAGGGCACAGG + Exonic
1166406940 19:42528274-42528296 CCCTGGGAAGGGGCGGAAAGAGG - Intronic
1166673444 19:44725210-44725232 GCGGGGGCGGGGGAGGGCAGGGG - Intergenic
1166750232 19:45161049-45161071 GCTGGGGAAGGGGCGGGGACAGG - Intronic
1166823917 19:45597781-45597803 CCAGGGGAAGAGGTGGTCAGGGG + Intronic
1166853031 19:45769328-45769350 CCGGGAGGAGGGGCGGGGAACGG + Intergenic
1166884948 19:45954509-45954531 CTGGGGGATGGGGGAGGCAGAGG + Intronic
1166888109 19:45973569-45973591 GCGGGGGAGGGGGAGGGGAGGGG + Intergenic
1167001138 19:46746312-46746334 CCGGGGGCAGGGGCGGAGACCGG + Exonic
1167027809 19:46934364-46934386 CCGGGAGGAGGGGCGGGGTGGGG - Intronic
1167071726 19:47226129-47226151 CCGGGCGCCGGGGCGGGCCGGGG - Intronic
1167111697 19:47466307-47466329 CCGGGGGAGGCGGCAGGGAGGGG + Exonic
1167211351 19:48135940-48135962 GCTGGGGAAGGGGCGGGCATGGG + Intronic
1167265492 19:48480939-48480961 GCGGCGGGAGGGGAGGGCAGAGG + Intronic
1167383761 19:49152530-49152552 CCAGGGGCAGGGGAGGGGAGGGG - Intronic
1167441846 19:49513330-49513352 CGGGAGGAAGGGGCGGGCCGGGG + Intronic
1167454532 19:49591467-49591489 GCGGGGGAGGGAGGGGGCAGGGG - Intergenic
1167493845 19:49806774-49806796 CCGGGGGATGTGGCCGGCACTGG + Exonic
1167636747 19:50659882-50659904 AAGGGGGAGGGGGCGGGTAGGGG + Intronic
1167696604 19:51019013-51019035 CGGGGGCAGGGGGCGGGGAGAGG - Intronic
1167703617 19:51065605-51065627 CCTGGGGCGGGGGCGGGGAGCGG - Intergenic
1168056780 19:53868843-53868865 CCGAGGGGAGGGGAGGGGAGGGG - Intronic
1168060321 19:53888373-53888395 CCGGGGGTAGTGGGTGGCAGGGG + Intronic
1168279522 19:55297305-55297327 CAGGAGGAAGAGGCGGGCGGAGG - Intronic
1168282551 19:55313161-55313183 ACGGGGGAAGGGGAGAGCTGAGG - Intronic
1168414631 19:56160408-56160430 CAGGGAGAAGGGGGGGGCTGAGG - Exonic
925148626 2:1599856-1599878 CAGAGGGAAGGGGCAGGCAAAGG - Intergenic
925337491 2:3108842-3108864 CCTGGAGAAGGCGAGGGCAGTGG - Intergenic
925744771 2:7034514-7034536 CCGGAGGAAGGACAGGGCAGGGG - Intronic
925755386 2:7128078-7128100 GAGGGGGAAGGGGAGGGGAGGGG - Intergenic
926146248 2:10398667-10398689 GCGGGGCAGGGGACGGGCAGAGG - Intronic
926286799 2:11495049-11495071 CCGGGGGCAGGGGCAAGCGGGGG - Intergenic
927207818 2:20621128-20621150 CCTGGGGCAGGGCCGGGCAGGGG + Intronic
927232125 2:20834584-20834606 AAGGGGGAAGGGGAGGGGAGGGG - Intergenic
927516353 2:23674099-23674121 CCGGGGCAAGTGCTGGGCAGAGG - Intronic
927708440 2:25311121-25311143 CTGGGGGCGGGGGCGGGGAGGGG + Intronic
927752753 2:25684706-25684728 CTGGGGGAAGAGGTGCGCAGTGG + Intergenic
927900100 2:26812868-26812890 CTGGAGGAAGGGGAGGGCTGAGG - Intergenic
928232862 2:29514996-29515018 CCAGGGGAAAGGACAGGCAGAGG - Intronic
929444585 2:41992166-41992188 AAGGGAGAAGGGGAGGGCAGGGG + Intergenic
929510116 2:42559799-42559821 CCGGGGCGGGGGGCGGGCAGGGG + Intronic
929542239 2:42831279-42831301 CCTGGGGAAGGGGCTGGTGGTGG + Intergenic
930762298 2:55050002-55050024 ACGGGGGGAGCGGCCGGCAGGGG + Exonic
931253485 2:60552382-60552404 CCGGGGGAGGAGGCGGCCGGGGG - Intronic
931253767 2:60553827-60553849 CCCGGGGGAGGGGCGGGCCGAGG + Intergenic
931292076 2:60881814-60881836 CTGCGGGAAGGTGCGGGGAGCGG + Exonic
931348769 2:61470700-61470722 GCGGGGGAGGGGGGGGGCGGCGG - Exonic
931728176 2:65130485-65130507 ACGGGGGAGGGGGCGGAGAGGGG + Intergenic
931762834 2:65432212-65432234 CCGTGGGGAGAGGCGGGCGGAGG + Intronic
931763475 2:65435803-65435825 CCGCGGGAAGGGCCGGGGTGGGG - Intergenic
931914923 2:66943592-66943614 GCGGGGGGAGGGGGAGGCAGGGG + Intergenic
932191046 2:69741888-69741910 CCGGGGGACCGGGCGGGCCTGGG + Intronic
932408972 2:71534072-71534094 GAGGGGGAAGGTGGGGGCAGGGG + Intronic
932615413 2:73228274-73228296 CCTGGGGAAGGGAAGGCCAGTGG + Exonic
932773232 2:74513291-74513313 CCGGGGGCCGGGGCGGGCCGGGG + Intergenic
933221401 2:79693707-79693729 CAGGGGCAAGTGGTGGGCAGAGG + Intronic
933787418 2:85854484-85854506 CAGGGAGAAGGGGCAGGGAGCGG + Intronic
933793502 2:85902388-85902410 CCTGGGGAAGGGGAGGAAAGAGG - Intergenic
933893463 2:86790731-86790753 GCAGGGGATGGGGCGGGCGGGGG - Intronic
934044089 2:88157178-88157200 CAGGGGGAAAGGGTGGGAAGTGG - Intergenic
934045516 2:88170265-88170287 CCTGGGGATGGGGCGGGGGGCGG - Intergenic
934487966 2:94735734-94735756 CCGGAGGAAGGCGCGCGCGGTGG - Intergenic
934557948 2:95297281-95297303 AGGGAGGAAGGGGTGGGCAGGGG + Intergenic
934561961 2:95318057-95318079 CAGGGGGCAGGGGTGGGCAGTGG + Intronic
934735631 2:96688456-96688478 CCTGGGGAGTGGGCGGGCGGTGG + Intergenic
934736917 2:96694238-96694260 CCATGGGTAGGGGCTGGCAGGGG - Intergenic
936106103 2:109625903-109625925 CCGGGAGAAGGGGAGTGAAGTGG + Intergenic
936144038 2:109967282-109967304 CAGGAGGAAGGGGCTGGCTGTGG - Intergenic
936180720 2:110265243-110265265 CAGGAGGAAGGGGCTGGCTGTGG - Intergenic
936200649 2:110404187-110404209 CAGGAGGAAGGGGCTGGCTGTGG + Intronic
937094091 2:119224420-119224442 CCGCGGGCAGAGGCGGGCACTGG - Intronic
937227328 2:120377365-120377387 CTGGGAGTAGGGGCGGGCAGGGG - Intergenic
937257240 2:120564274-120564296 CCTGGGGGCGAGGCGGGCAGAGG + Intergenic
937260862 2:120586246-120586268 CTCGGGTAAGGGGTGGGCAGGGG - Intergenic
937296856 2:120814773-120814795 GCGGGGGGTGGGGCGGGCGGGGG - Intronic
937345215 2:121121162-121121184 ACTGTGGAAGGGGAGGGCAGGGG + Intergenic
938034837 2:128027501-128027523 CCGGCGAAGGGGGCGGGGAGCGG + Intronic
938258323 2:129877691-129877713 CCTGGGGAGGGGGCGGGGACAGG + Intergenic
938292932 2:130159926-130159948 CCGGCGGCAGGGGCGGACAGTGG - Intronic
938463623 2:131513038-131513060 CCGGGGGCAGGGGTGGACAGTGG + Intergenic
938555856 2:132423621-132423643 CCTGGGGAAGGGGATGGAAGTGG - Intronic
938573666 2:132584955-132584977 ACGGGGGAAGGGGAGGCCATGGG + Intronic
938783221 2:134603835-134603857 GTGGGGGAAGGGGAGGGGAGGGG + Intronic
938817387 2:134918493-134918515 GGGAGGGAAGGGGCGGGGAGGGG - Intronic
939981331 2:148785326-148785348 CTCGGGGGTGGGGCGGGCAGTGG - Intronic
940037881 2:149329840-149329862 CTGGAGGAAGGGTTGGGCAGAGG + Intergenic
940045144 2:149401858-149401880 TCGGGGGAAGGGGTGGGGGGTGG - Intronic
940420790 2:153477873-153477895 CAGGTGGAGAGGGCGGGCAGGGG - Exonic
940901664 2:159131508-159131530 GCAGGGGAAGGGGCGGGGGGAGG - Intronic
942393309 2:175519280-175519302 CAGGGGGAAAGGGTGGGAAGGGG + Intergenic
942434011 2:175951365-175951387 TCAGGGGAAAGGGCGGGAAGGGG - Intronic
942445074 2:176072178-176072200 CGGGCGGAAGAGGCGGTCAGGGG - Intergenic
943377761 2:187100938-187100960 CCGGGCGTAGTGGCGGGCACCGG - Intergenic
943401019 2:187410884-187410906 TCGGGGCAGGGGGCGGGGAGAGG + Intronic
944586255 2:201176278-201176300 CGGGGGGGGGGGGCGGGCGGGGG + Exonic
945124282 2:206491147-206491169 GCAGGGGTAGGGGCAGGCAGAGG - Intronic
945245366 2:207712154-207712176 CTGGGGGAGGAGGCGGGCAGAGG - Intronic
945579972 2:211581111-211581133 CAGGGGGAAAGGGTGGGGAGGGG + Intronic
946040810 2:216781318-216781340 CAGAGGGGAGGGGAGGGCAGGGG - Intergenic
946185493 2:217978556-217978578 GCGGGGGCAGGGGCGGGCTGGGG - Intronic
947156305 2:227165021-227165043 CTGGGGGAAGAGGCGAGGAGGGG + Intronic
947500693 2:230668754-230668776 CCTGGGGCCGGGCCGGGCAGAGG - Intergenic
947592952 2:231395647-231395669 GCGGGAGGAGGGGCCGGCAGGGG - Exonic
947743732 2:232497012-232497034 CCTGGGGCAGGGGCAGCCAGCGG + Intergenic
947792632 2:232876800-232876822 CCGGGAGAAGGGGCCGCCCGTGG - Intronic
948065107 2:235072474-235072496 CAGGGGGAAAGGGTGGGAAGGGG + Intergenic
948097027 2:235343569-235343591 CCCAGGGAAGAGGCGGGGAGAGG + Intergenic
948274026 2:236694753-236694775 CCTGGGAAAGGGCTGGGCAGTGG - Intergenic
948479599 2:238241155-238241177 CCGGGGCAGGAGCCGGGCAGGGG - Intergenic
948591716 2:239054626-239054648 CCTGGGGAAGCAGCCGGCAGTGG + Intronic
948632677 2:239312162-239312184 CTGGAAGGAGGGGCGGGCAGGGG + Intronic
948798737 2:240420521-240420543 CCGGGAGAATGGGAGGGCTGAGG + Intergenic
948836148 2:240626861-240626883 CAGGGGGAAGGGCTGGGGAGGGG + Intronic
948945900 2:241218501-241218523 CCGGGGGAGGGGGGGAGCTGGGG + Intronic
1168869790 20:1118607-1118629 CCCGGGGACGGGGCGGGGCGGGG - Exonic
1168892668 20:1305180-1305202 GCGGGTGAGGGAGCGGGCAGGGG - Exonic
1169087439 20:2836129-2836151 CCTGGGGCAGGGGTGGGAAGAGG + Exonic
1169120060 20:3090240-3090262 CCTGGGGAGGGTGCGGGTAGAGG - Intergenic
1169497034 20:6124974-6124996 TCGGGGGTAGGGGCAGGCAGCGG - Intergenic
1170612127 20:17923354-17923376 CGGGGGCGGGGGGCGGGCAGGGG - Intergenic
1170650045 20:18230960-18230982 CAGGGGGAAAGGGTGGGAAGGGG - Intergenic
1170773228 20:19352121-19352143 TCGGTGGGAGGGGCGGGGAGGGG + Intronic
1170924858 20:20713081-20713103 CCGGGGCAGGGGACGGACAGAGG - Intergenic
1170930607 20:20766988-20767010 CTGGGGAAAGGGGAGGGCAGGGG - Intergenic
1171452760 20:25247783-25247805 CCCGGGGACGGTGCGGGAAGGGG - Intergenic
1171823284 20:29874507-29874529 CCGGGGGAAGGGGCGGGCAGGGG + Intergenic
1172178504 20:32986791-32986813 GCGGGGGACGCGGCGGGCAGTGG - Intronic
1172201323 20:33128501-33128523 CAGGGGGAAAGGGTGGGAAGGGG - Intergenic
1172202052 20:33133477-33133499 CCGGGGCCAGGGGTGGGCAGAGG - Intergenic
1172379440 20:34475714-34475736 GCAGGGGCAGGGGCAGGCAGAGG + Intronic
1172689921 20:36783243-36783265 CTGGGGGAAAGGGCTGGCACAGG + Exonic
1172752352 20:37259613-37259635 TTGGGAGAAGGGGCAGGCAGAGG - Intronic
1173201082 20:40955489-40955511 CAGGGGGAGGAGGTGGGCAGAGG + Intergenic
1173438834 20:43057277-43057299 GGGGGGGAAGGGGAGGGGAGGGG + Intronic
1173708774 20:45136220-45136242 CCATGGGAAGGGTAGGGCAGGGG - Intergenic
1173897837 20:46564111-46564133 CTGAGGGAAGGAGCAGGCAGAGG - Intronic
1173909197 20:46651490-46651512 CCTGGGGGAGGGTCGGGGAGGGG + Intronic
1173972020 20:47160490-47160512 GCGGGGGGCGGTGCGGGCAGTGG + Intronic
1174207322 20:48850269-48850291 CCGGGGCAAGCGGAGGGCCGAGG + Intergenic
1174362978 20:50040129-50040151 CCGGGGACAGGGAGGGGCAGGGG - Intergenic
1174777713 20:53361056-53361078 CCTGGGGGCTGGGCGGGCAGCGG - Intronic
1175340942 20:58228614-58228636 CTGGGGGATGCGGCGGGCGGCGG - Exonic
1175509232 20:59511188-59511210 CAGGGGGAAAGGGTGGGAAGGGG - Intergenic
1175510942 20:59525771-59525793 CCGGCCGAAGGCGCGGGCTGCGG + Intergenic
1175818956 20:61898153-61898175 CCGTGGGACGGAGCAGGCAGAGG + Intronic
1175856154 20:62122166-62122188 GCGGGGGGAGGGGTGGGAAGCGG - Intergenic
1175856392 20:62122937-62122959 CGGGGTGAAGGCGCGGGCAGGGG - Intronic
1175933121 20:62502756-62502778 CCAGAGGAAGGGGCTGGCAGGGG - Intergenic
1176016789 20:62938094-62938116 GCGGGGGCGGGGGCGGGGAGCGG - Intergenic
1176085601 20:63294171-63294193 GCGGGGGAGGGGGCGTGCAGGGG + Intronic
1176112460 20:63416852-63416874 CTGGGGGATGGGGTGGGGAGGGG - Intronic
1176156949 20:63626828-63626850 GCGGGGGGAGGGGAGGGCCGGGG - Intronic
1176162094 20:63653239-63653261 CCTGGGGCAGCGGCCGGCAGCGG - Intronic
1176201733 20:63863964-63863986 CCGGGTGAAGGAAGGGGCAGTGG + Intergenic
1176384604 21:6132777-6132799 CAGGGGGAAAGGGCGGGAAGGGG - Intergenic
1176868796 21:14071324-14071346 CCTGGGGAAGTTGCGGGCAGGGG + Intergenic
1177541040 21:22494042-22494064 CTGGGGGAAGGAGCGGCCATGGG + Intergenic
1178323497 21:31624383-31624405 CAGGGGGAAGGTAGGGGCAGAGG - Intergenic
1178349178 21:31859630-31859652 CAGGGGGAAAGGGCGGGAAGGGG - Intergenic
1178401562 21:32290401-32290423 CAGGGGGAAAGGGTGGGAAGCGG + Intergenic
1178793893 21:35725296-35725318 TCGGGGGAAAGGGTGGGAAGGGG - Intronic
1178824687 21:36005065-36005087 CCGGGGGAAGGGGTGCGGGGGGG + Intergenic
1179229892 21:39492227-39492249 CAGGGGGAAAGGGTGGGAAGGGG - Intronic
1179617924 21:42593728-42593750 CCGGGGACAGGGGCTGGCCGAGG + Intergenic
1179626814 21:42653715-42653737 GCAGGGGAGGGGGCGGGCGGGGG - Intronic
1179674945 21:42974823-42974845 CCGGGGCAGGGGGCGGGGAGGGG + Intronic
1179738868 21:43405475-43405497 CAGGGGGAAAGGGCGGGAAGGGG + Intergenic
1180051307 21:45332135-45332157 CAGGGGGAAGGGGCTGAGAGCGG + Intergenic
1180064324 21:45405114-45405136 GCCGGGCAGGGGGCGGGCAGGGG - Intergenic
1180086611 21:45510505-45510527 CCGGGGGAGCGGGGGGTCAGGGG - Intronic
1180090402 21:45531146-45531168 ACGGGGCAGGGGGCGGGGAGGGG + Intronic
1180090424 21:45531190-45531212 ACGGGGCAGGGGGCGGGGAGGGG + Intronic
1180231881 21:46431228-46431250 TCTGGAGAGGGGGCGGGCAGGGG + Intronic
1180699630 22:17774307-17774329 CCGGGGCAGGCGGCAGGCAGGGG + Intronic
1180787089 22:18553304-18553326 GTCGGGGAAGGGGCGTGCAGCGG + Intergenic
1180891448 22:19291797-19291819 GCGGGGGAAGGGGCGGGGAAAGG - Intergenic
1181234651 22:21442002-21442024 GTCGGGGAAGGGGCGTGCAGCGG - Intronic
1181243998 22:21492829-21492851 GTCGGGGAAGGGGCGTGCAGCGG + Intergenic
1181299284 22:21867764-21867786 CCGGCGGAAGCGGCGGGCTTCGG + Intergenic
1181307093 22:21923057-21923079 TGGGAGGAAGGGGAGGGCAGGGG + Exonic
1181477995 22:23180485-23180507 CCGCAGGAAGGGGAGGGCCGGGG - Exonic
1181902819 22:26169773-26169795 CCGAGGGGCGGGGCGGGCAGGGG + Intronic
1182257495 22:29049503-29049525 CCTGCGGAAGGGGTGGGCTGGGG - Exonic
1182355248 22:29719915-29719937 CGGCGGGAAGGGGCGGGCTGGGG + Intergenic
1182622524 22:31625869-31625891 TCGGGGGAAGGGGAGGAAAGAGG - Exonic
1183154697 22:36066085-36066107 CCGGGGGACGGCGCCAGCAGGGG - Intergenic
1183208145 22:36433397-36433419 GCTGGGGAAGGGACGGGGAGAGG - Intergenic
1183208254 22:36433811-36433833 CCAGCGGGAGGGGCGGGCTGGGG + Intergenic
1183230064 22:36576371-36576393 CAGGGGGAAAGGGTGGGGAGAGG + Intronic
1183393749 22:37560425-37560447 CCGGGGGCGGGGGCGGGGTGTGG - Exonic
1183438128 22:37807111-37807133 GAGGGGGAGTGGGCGGGCAGTGG + Exonic
1183472430 22:38016731-38016753 CGGGGGGAGGGGGCGGGAGGGGG + Intronic
1183605939 22:38866705-38866727 CCGGGGGACGGGGCTACCAGGGG + Exonic
1183647547 22:39135153-39135175 CCGGGAGATGGTGCAGGCAGAGG + Intronic
1184108365 22:42381570-42381592 CCAGGGGCAGGGGCCTGCAGGGG + Exonic
1184472131 22:44702138-44702160 CCGGGGGGCGGGGCGGGGAAGGG - Intronic
1184642702 22:45880825-45880847 CAGGGGGAGGGGCCGGGCGGAGG - Intergenic
1184697987 22:46150440-46150462 CCGGGGCAGGGGGCGGGCCGAGG + Intergenic
1184849954 22:47114337-47114359 CCGGGAGGAGGCGCTGGCAGAGG + Intronic
1185046450 22:48530958-48530980 GCTGGGGTCGGGGCGGGCAGGGG - Intronic
1185098752 22:48826346-48826368 CCGGGGGGAGGAGCAAGCAGAGG - Intronic
1185247654 22:49781604-49781626 CCAGCGGCAGGGGCGGGCAGGGG - Intronic
1185258258 22:49848535-49848557 CCGGGGGTGGGAGCGCGCAGCGG - Intergenic
950109181 3:10407578-10407600 CCTGGGGCGGAGGCGGGCAGTGG + Intronic
950110721 3:10417066-10417088 CGGCGGGGGGGGGCGGGCAGAGG + Intronic
950161752 3:10765629-10765651 GCGGGGGGAGGGGCTGGCAGGGG - Intergenic
950654645 3:14429029-14429051 CTGGGGGTAGGGGGGTGCAGAGG - Intronic
951487418 3:23229439-23229461 CAGGGGGAAAGGGTGGGAAGAGG - Intronic
952768617 3:36977003-36977025 CCTGGGGAAGGGAAGGTCAGTGG - Intergenic
953405592 3:42658210-42658232 GCTGGGGGAAGGGCGGGCAGGGG + Intronic
953686334 3:45081179-45081201 CCAGGAGAAGGGGCAGTCAGAGG + Intergenic
953761296 3:45689338-45689360 GCGGGGAAAGGGGTGGGAAGAGG + Exonic
953991815 3:47489753-47489775 GGGGGGGAAGAGGAGGGCAGGGG - Intergenic
954025653 3:47781509-47781531 CGGGGGGGAGGGGCGGCCCGAGG + Intronic
954096543 3:48333046-48333068 CCGGGGGAACGCCGGGGCAGGGG + Intergenic
954110220 3:48429393-48429415 CGCGCGGGAGGGGCGGGCAGCGG - Exonic
954300700 3:49699388-49699410 CCGGGGTGGGGGGTGGGCAGTGG + Intronic
954411862 3:50374346-50374368 GAGGGGGAAGGGGAGGGGAGGGG + Intronic
954439833 3:50515832-50515854 GTGGGGAAAGGGGCGGGCAGAGG - Intergenic
954615611 3:51967529-51967551 TCCGGGGAGGGGGCGGGGAGGGG - Intronic
954681844 3:52350165-52350187 CCGAGGGCTGGGGCAGGCAGGGG + Intronic
954708884 3:52495317-52495339 AGGCGGGACGGGGCGGGCAGTGG - Exonic
956427811 3:69154926-69154948 CAAGGGGAAGAGGCGGGGAGGGG + Intergenic
956594329 3:70949487-70949509 CCGGGGGATGGGGCATGGAGTGG + Intergenic
958012200 3:87894173-87894195 CAGGGGGAAAGGGTGGGAAGAGG - Intergenic
959023062 3:101210215-101210237 CAGGGGGAAAGGGTGGGAAGGGG - Intergenic
959671487 3:108982575-108982597 TCGTGGGATGGGGGGGGCAGGGG + Intronic
959893312 3:111580660-111580682 CAGAGGGAAGGGGAGGACAGAGG - Intronic
960684718 3:120285125-120285147 GGGCGGGAAGGGGCGGGCCGGGG + Intergenic
960973669 3:123156390-123156412 GCAGGGAAAGGGGCAGGCAGAGG - Intronic
961133683 3:124491275-124491297 GGCGGGGAAGGGGAGGGCAGTGG - Intronic
961638946 3:128352717-128352739 CCCAGGGAGGGGGCAGGCAGAGG + Intronic
961841913 3:129721423-129721445 CCCGGGGCAGGGTAGGGCAGTGG - Intronic
961940949 3:130636919-130636941 GAGGGGGAAGGGGAGGGGAGGGG - Intronic
962309178 3:134313404-134313426 GGGCGGGTAGGGGCGGGCAGGGG + Intergenic
962367648 3:134796624-134796646 GCGGGGGAAGGGGCGGGAGGCGG - Intronic
962382240 3:134907648-134907670 GGTGGGGAGGGGGCGGGCAGGGG - Intronic
962707648 3:138061153-138061175 CTGGGGGAGGGGGCAGGCTGGGG - Intergenic
962932156 3:140048699-140048721 CTGGGGGGAGTGGGGGGCAGTGG + Intronic
963142469 3:141958558-141958580 CCTGGGGCAGGGGCATGCAGTGG + Intronic
964087550 3:152835636-152835658 CCGCGGGAGGGGGCGCGCAGGGG - Exonic
965025546 3:163297311-163297333 CTGGGGGAAGGGGCGGCCATGGG + Intergenic
965520202 3:169662947-169662969 TGGGGGGAAGGGGAGGGGAGGGG + Intronic
965881710 3:173395825-173395847 CCGGCGGGAGGGGCGCGCAGGGG + Intergenic
966362736 3:179148163-179148185 CCGGAGGAGGGGGGGGGCCGAGG + Intronic
966489975 3:180516850-180516872 CTGGTGGCAGGGTCGGGCAGGGG - Intergenic
966874844 3:184315824-184315846 CCGGGGGATGGGGCGGGTGGGGG - Exonic
966936311 3:184711888-184711910 CCGGGGGAGGGGTTGGACAGCGG + Exonic
967054754 3:185822835-185822857 CTGGGGGTAGGGGCGGGAGGTGG + Intronic
967146844 3:186613484-186613506 GTGAGGGAAGGGGCAGGCAGAGG + Intronic
967847912 3:194058527-194058549 CCGGGTGGCGGGGCGGGCAGCGG + Intergenic
967904197 3:194487077-194487099 GGCGGGGAAGGGGCGGGGAGGGG + Intronic
968092228 3:195906571-195906593 CCTGGGGTAGGGGATGGCAGAGG + Intronic
968479236 4:826336-826358 CCGGGGGCGGGGGCGGGGGGCGG + Intergenic
968479290 4:826421-826443 CCGGGGGCGGGGGCGGGGGGCGG + Intergenic
968517309 4:1020718-1020740 GCAGGGGAAGGGGCGGGGTGGGG + Intronic
968517372 4:1020840-1020862 GCAGGGGAAGGGGCGGGGTGGGG + Intronic
968517433 4:1020961-1020983 GCAGGGGAAGGGGCGGGGTGGGG + Intronic
968517463 4:1021019-1021041 GCAGGGGAAGGGGCGGGGTGGGG + Intronic
968572082 4:1347189-1347211 CCGCCGGAAGGGGCGGGGCGAGG + Intergenic
968609428 4:1550348-1550370 CCAGGGGCAGGGGAGGGCATTGG - Intergenic
968913411 4:3486847-3486869 GCGGGGACAGGGCCGGGCAGGGG + Intronic
969371677 4:6735326-6735348 CCAGGTGAAGGGGCTGGGAGGGG + Intergenic
970151179 4:13092130-13092152 CAGGGGGAAAGGGTGGGAAGGGG + Intergenic
970448073 4:16140492-16140514 CTGGGGGAAGGGGTGGGTGGCGG - Intergenic
970494249 4:16609338-16609360 CCAGGGGAGGGGGCGGGGGGGGG + Intronic
972327299 4:38028767-38028789 AAGCGGGAAGGGGCGGGCAGAGG - Intronic
972543312 4:40057277-40057299 CCGGGCGAAGGCGGGGGCCGCGG + Intronic
973037722 4:45427323-45427345 CAGGGGGAAAGGGTGGGAAGGGG - Intergenic
973070336 4:45850504-45850526 CCGGGGGAAAGTGTGGGAAGGGG - Intergenic
973243919 4:47989793-47989815 CAGGGGGAAAGGGTGGGAAGGGG - Intronic
973864186 4:55095312-55095334 GCGAGGAAAGGGGAGGGCAGAGG - Intronic
974276826 4:59731360-59731382 CAGGGGGAAAGGGTGGGAAGAGG + Intergenic
975305716 4:72846802-72846824 CTGGGGGAAGGGGCGGCTGGGGG + Intergenic
976157658 4:82164566-82164588 CCGGGGGAAAGGGTGGGAAGGGG + Intergenic
976401831 4:84615572-84615594 CAGGGGGAGGGGGTGGGCAACGG - Intronic
978127170 4:105147834-105147856 CCCGGGGAGGGGGCGGGAGGGGG + Intronic
980935215 4:139219623-139219645 CCGGGGGGTGGGGATGGCAGTGG + Intergenic
981069922 4:140524112-140524134 CGGAGGGGCGGGGCGGGCAGTGG + Intergenic
981429715 4:144645616-144645638 ACGGGGCGAGGGGCGGGCCGGGG + Intergenic
981516882 4:145619361-145619383 CCGGCGGAAGGGGCGGGGTCAGG + Exonic
981615342 4:146638836-146638858 GCGGGGGTAGGCGCGGGGAGAGG + Intergenic
981938146 4:150255827-150255849 CCGGGGGAAGGGGCTGTCCTTGG - Intronic
982048289 4:151471763-151471785 CAGGGGGAATGGGTGGGAAGAGG - Intronic
982107880 4:152026428-152026450 CCGGGGGGAGGGGGGAGCTGGGG + Intergenic
982281113 4:153684405-153684427 CCTGGGGTCGGGTCGGGCAGGGG + Intergenic
982281223 4:153684781-153684803 CCGAGGGAGGTGGCGGCCAGAGG - Intergenic
983904415 4:173169158-173169180 GCGGAGGAAGGGGCGGCGAGGGG - Intronic
983938548 4:173519479-173519501 CGTGGGGAGGGGGCGGGCTGGGG - Intergenic
983949405 4:173622163-173622185 CTGGGGGAAGGGGCGGCTATGGG - Intergenic
984781941 4:183533940-183533962 CCGGGGCAGGGGGAGGGCTGTGG + Intergenic
984826062 4:183925470-183925492 CCGGGGGAGGGGCCGGGGAAGGG - Intronic
985444729 4:190015574-190015596 CCGGGGGAAGGGGCGGGCAGGGG + Intergenic
985478417 5:92347-92369 GCGGGGGTAGGGGCGGGGTGGGG + Intergenic
985534538 5:456642-456664 CCGGGGAAAGTGCAGGGCAGGGG - Intronic
985790857 5:1926298-1926320 GCAGGGGAAGGGGCAGGCACAGG - Intergenic
986259933 5:6135065-6135087 CTGGGGTAGGGGGTGGGCAGGGG + Intergenic
986330431 5:6713375-6713397 GCGGGGGAGGGGGCGGGGACGGG - Intergenic
986983884 5:13478966-13478988 CCGGTGGAAGGTGTGGCCAGAGG - Intergenic
987084639 5:14457379-14457401 CCGGGGGGCGGGGCGGGGGGGGG - Intronic
987156746 5:15096621-15096643 CGGGGGGTGGGGGCGGGCGGGGG + Intergenic
987232936 5:15913929-15913951 TCGGGGGTTGGGGAGGGCAGGGG + Intronic
987327614 5:16826580-16826602 CGGGAGGAAGGAGCGGGCAAAGG + Intronic
987358257 5:17083686-17083708 CGCGGGGAAGGGGAGGGGAGGGG + Intronic
988338037 5:29931524-29931546 CTGGGGGAGGGGGCGGAGAGTGG + Intergenic
988437500 5:31193618-31193640 CAAGGGGAGGGGGCGGGCGGGGG + Intergenic
989178876 5:38556709-38556731 CCGGGGGCAGGGGCGGGTCAGGG - Intronic
989288305 5:39730207-39730229 CAGGGGGCAGGGGCGGGCAGAGG - Intergenic
990003443 5:50921480-50921502 CCAGGGGCAGGGGAGGGCATTGG + Intergenic
991473783 5:66998655-66998677 GGGGGTGAAGGGGTGGGCAGGGG - Intronic
992052514 5:72954568-72954590 CGGGGGGAAGGGGGGGGGCGCGG + Intergenic
992474001 5:77084658-77084680 ACTGGGGAAGGGGTGGGCATGGG + Intronic
992627565 5:78648892-78648914 CCGGGGGAGGGGTCGGGCTCGGG + Intronic
992796100 5:80256137-80256159 GCCCGGGAAGGGGCGGGCACGGG - Intergenic
993501916 5:88674874-88674896 CCAGAGGAGGGGGCGAGCAGAGG + Intergenic
993609062 5:90032055-90032077 CTAGGGGAAGGGGCGGCCATGGG + Intergenic
993905708 5:93621234-93621256 CAGGCGGGAGGGGCGGGGAGGGG - Intronic
994221914 5:97206070-97206092 CAGGGGGAAAGGGCGGGAAGGGG - Intergenic
996136312 5:119846548-119846570 TCGGGGGAAAGGGTGGGAAGGGG + Intergenic
997582115 5:135024629-135024651 CCTGGGGTAGGGGCAGACAGAGG - Intergenic
997596956 5:135113475-135113497 GCAGGGGCAGAGGCGGGCAGGGG - Intronic
997903877 5:137794978-137795000 CGGGGGGGAGGGGCGGGGGGCGG + Intergenic
997955606 5:138276228-138276250 CTGGAGGAGGGGGAGGGCAGAGG - Intergenic
998377068 5:141698273-141698295 CTGGGGGAAGGGGAGGGTACTGG - Intergenic
998378657 5:141708506-141708528 CCGGGGGATGGGATGGGGAGTGG - Intergenic
998459801 5:142301548-142301570 CAGGGGGAAGGGGCAGACACAGG - Intergenic
999195658 5:149779898-149779920 CCAGGGGAAGGGGCTGGGAAGGG - Intronic
999256397 5:150212052-150212074 CCGGTGGCAGGAGTGGGCAGGGG - Intronic
1000107279 5:158072093-158072115 CCAGGGGAAGGGGTGTGAAGGGG + Intergenic
1000303054 5:159972610-159972632 CCGGGGGGAGGGCCGGGGAGAGG + Intergenic
1000305097 5:159987475-159987497 CAGGGGAAAGGGGCGTGGAGCGG - Intergenic
1000590901 5:163156405-163156427 CAGGGGGAAAGGGTGGGCAATGG - Intergenic
1000942988 5:167385653-167385675 CAGGGGGAAAGGGTGGGAAGGGG - Intronic
1001299399 5:170523169-170523191 CCGGTGGCAGGGTGGGGCAGGGG - Intronic
1001403662 5:171461192-171461214 AGTGGGGAAGGGGAGGGCAGTGG + Intergenic
1001404975 5:171469804-171469826 CCGGGGGTGGGGAGGGGCAGGGG - Intergenic
1001559314 5:172659025-172659047 GGGGGGGGGGGGGCGGGCAGGGG - Intronic
1001617776 5:173056678-173056700 CCGGGGGTGGGGGAGGGGAGCGG - Intronic
1001707116 5:173749652-173749674 TGGAGGGAAGGGGCGGGAAGCGG - Intergenic
1001796635 5:174507590-174507612 CAGGGGGAAAGGGTGGGAAGGGG - Intergenic
1002300145 5:178253244-178253266 CCGGGGCAGGGGTGGGGCAGGGG - Intronic
1002455710 5:179344694-179344716 CGGGGAGACGGGGCCGGCAGCGG - Intronic
1002508731 5:179698909-179698931 CAGGGGCCAGGGGCGGGCACAGG + Exonic
1002523419 5:179803574-179803596 TCGGGGGTGGGGGTGGGCAGTGG - Intronic
1002524409 5:179807158-179807180 CCGGGGCGGGGGGCGGGCGGCGG + Intronic
1002608854 5:180400578-180400600 CCAAGGGCAGGGGAGGGCAGGGG + Intergenic
1002697608 5:181100977-181100999 GCGAGGGGAGGGGAGGGCAGGGG - Intergenic
1002697623 5:181101007-181101029 GCGAGGGGAGGGGAGGGCAGGGG - Intergenic
1002784798 6:392688-392710 CGCGGGGAAGGGGCGAGAAGCGG + Intronic
1003034169 6:2628542-2628564 CCGGGGGAAGGAGAGGAAAGTGG + Intronic
1003184884 6:3822007-3822029 CAGGAGGATGGGGAGGGCAGAGG + Intergenic
1004438462 6:15621823-15621845 CCGGGGTTAGGGACAGGCAGAGG - Intronic
1004513901 6:16305961-16305983 CCGTGGGAAGGGTCCTGCAGGGG - Exonic
1004607291 6:17206450-17206472 CAGGGGGAGGGGGCGGGGAGGGG + Intergenic
1004617389 6:17303514-17303536 GAGGGGGGAGGGGAGGGCAGGGG + Intergenic
1005049708 6:21673466-21673488 CAGGTGAAAGGGGTGGGCAGGGG + Intergenic
1005100105 6:22162704-22162726 CAGGGGGAAAGGGTGGGAAGGGG - Intergenic
1005439255 6:25847892-25847914 CAGGGGGAAGGTGTGGGAAGGGG - Intronic
1006160554 6:32038506-32038528 CCGGGGCAAGAGGCGGGAGGTGG - Exonic
1006358703 6:33575596-33575618 CCAGGAGAAGGGGCAGGCATGGG + Intronic
1006374339 6:33663593-33663615 CTGGGGGTAGGCGGGGGCAGGGG + Intronic
1006422655 6:33945011-33945033 CAGGGGGAAGGGGCGCTGAGGGG + Intergenic
1006497556 6:34434801-34434823 GCGGGGGAGGGGGTGGGCGGGGG - Intergenic
1006514632 6:34539152-34539174 ATGGGGGCAGGGGCGGGCAGAGG - Intronic
1006682637 6:35808106-35808128 GCCGGGGCAGGGGTGGGCAGTGG + Intronic
1006699755 6:35962485-35962507 GCTGAGGAAGGGGAGGGCAGAGG - Intronic
1006941280 6:37753767-37753789 CCTGGCCAAGGAGCGGGCAGGGG + Intergenic
1006941309 6:37753835-37753857 CCTGGCCAAGGAGCGGGCAGGGG + Intergenic
1006941336 6:37753903-37753925 CCTGGCCAAGGAGCGGGCAGAGG + Intergenic
1006945798 6:37783749-37783771 CCCGGGGAAGCGGGGAGCAGGGG - Intergenic
1006978751 6:38128480-38128502 CAGGGGGAAAGGGTGGGAAGGGG - Intronic
1007363068 6:41372483-41372505 TCTGGGGAAGGTGCGGGCTGGGG - Intergenic
1007390457 6:41547177-41547199 CCGGAGGCCGGGGCGGGGAGGGG + Intronic
1007680329 6:43629180-43629202 TCGGGGGAGGGGCCGGGCGGGGG - Intergenic
1007821209 6:44561690-44561712 CGGGGGGAAGGGGACGGGAGGGG + Intergenic
1007882826 6:45186154-45186176 CTGGGGGAAAGGGCAGGCAGTGG + Intronic
1007891399 6:45296409-45296431 CAGGGGGAAAGGGTGGGAAGGGG + Intronic
1008528130 6:52428336-52428358 CAGGGGGAAAGGGTGGGAAGGGG - Intronic
1008602876 6:53112794-53112816 CTGGGGCAAGGAGCTGGCAGTGG - Intergenic
1009428680 6:63542268-63542290 CAGGGGGAAAGGGTGGGAAGAGG + Intronic
1010006282 6:70998559-70998581 CCGGGGGAAAGGGGTGGCTGTGG + Intergenic
1010703233 6:79077566-79077588 CCGGGGCGCGGGGCGGGCGGGGG - Intronic
1011020641 6:82809087-82809109 CTGGGGGAAGGGGCGGCCACGGG - Intergenic
1011044671 6:83068007-83068029 CCGGGGCCTGGGCCGGGCAGAGG + Intronic
1011093006 6:83628001-83628023 CAGGGGGAAAGGGTGGGAAGAGG - Intronic
1011319488 6:86074953-86074975 CAGGGGGAAAGGGTGGGAAGAGG - Intergenic
1011387633 6:86815230-86815252 CTGGGGGAAGGGGCGGCTATGGG - Intergenic
1011734440 6:90297034-90297056 CCGGGGGCTGGGGCGGGGGGCGG + Intergenic
1012207908 6:96483905-96483927 CAGGGGGAAAGGGTGGGAAGTGG - Intergenic
1012410133 6:98947655-98947677 GGGCGGGGAGGGGCGGGCAGCGG + Intronic
1012958224 6:105593471-105593493 CCGGGTGAGGGGGTGGGGAGGGG + Intergenic
1013273479 6:108561923-108561945 CCAGGGCAAGGGGTTGGCAGGGG + Intronic
1013491061 6:110646591-110646613 ACGGCGGAGGGGGCGGGGAGGGG + Intronic
1013939640 6:115645695-115645717 CTGGGGGAAGGGGCGGCTATGGG + Intergenic
1013972958 6:116042293-116042315 CTGGGGGAAGGGGCAGGTATGGG + Intronic
1015181619 6:130366606-130366628 CGGAGGGGAGGGGAGGGCAGAGG - Intronic
1016994914 6:149954734-149954756 CCGGGGGTATCGGCCGGCAGCGG + Intergenic
1017003695 6:150014702-150014724 CCGGGGGTATCGGCCGGCAGCGG - Intergenic
1017073727 6:150599814-150599836 GCGCGGGGAGGGGCGGGCCGGGG + Intergenic
1017103127 6:150865858-150865880 CCGGGGGCTGGGGCGGGCGGCGG - Exonic
1018026925 6:159814026-159814048 CCCCGGGAAGGGGCAGGTAGGGG - Intronic
1018375025 6:163202146-163202168 CTGGGAGAAGGTGGGGGCAGAGG + Intronic
1018686532 6:166308099-166308121 CCCGGGGCGGGGGCGGGCGGCGG + Exonic
1018735065 6:166681681-166681703 GCGGGGGGGGGGGCGGGCAGGGG - Intronic
1018839444 6:167507902-167507924 ACGGGGGAAGGGAGGGGAAGGGG - Intergenic
1018876647 6:167827284-167827306 CGGGGGGGAGGGGCGGGGCGCGG - Intronic
1019197263 6:170289994-170290016 GCGCGGGGAGGGGCGGACAGCGG - Intronic
1019409875 7:901763-901785 CCGGAGGAAAGGGTGGGCGGGGG - Intronic
1019425697 7:975611-975633 CCTGGGCAAGGGGCGGGGACGGG - Intergenic
1019453145 7:1110019-1110041 CCGGGAGAAGGTGCCGGCATTGG - Intronic
1019523444 7:1470527-1470549 CCCGGGGACGGGACGGGCCGGGG + Exonic
1019564669 7:1673486-1673508 CCGGGGCAGGGGGCGGGGAGGGG - Intergenic
1019607100 7:1915435-1915457 CCAGGGGACGGCGCAGGCAGAGG + Intronic
1019711117 7:2518784-2518806 CCGGAGGACGTGGCGGGCAGGGG + Intronic
1019711165 7:2518919-2518941 CCGTGGGAAGGGCCGGGGATGGG + Intronic
1020080363 7:5283198-5283220 CCCGGGACAGGGGCGGGCTGGGG - Intronic
1020204706 7:6105359-6105381 CAGGCCGAAGGGGCGGGCTGGGG - Intronic
1020224838 7:6272270-6272292 CCGAGGGAGGGGGCGGGCCGGGG - Intronic
1021133419 7:16938036-16938058 CCTGGGGCAGGGACTGGCAGGGG + Intergenic
1022008980 7:26292354-26292376 CCGGGGAGAGGGTGGGGCAGAGG + Intronic
1022509071 7:30923661-30923683 GCAGGGGCAGGGGCGGGCGGAGG + Exonic
1022761892 7:33364628-33364650 GAGGGGGAAGGGGAGGGGAGAGG - Intronic
1023040951 7:36172893-36172915 CTGGGGGGTGGGGAGGGCAGGGG + Intronic
1023064827 7:36366979-36367001 CAGGGGAAAGGGCCGCGCAGGGG + Intronic
1023067199 7:36389766-36389788 CCGAGCGCAGGGGCGGGGAGAGG + Intronic
1023752719 7:43387210-43387232 CCAAGGGAAGGGGCTGGCTGGGG - Intronic
1023822184 7:43986433-43986455 CTGGGGGAAGGGGGTGGCTGGGG + Intergenic
1023881949 7:44325696-44325718 CGCGGGGAAGGCGCGTGCAGGGG - Intronic
1024305278 7:47923379-47923401 CAGGGGGAAAGGGTGGGAAGTGG + Intronic
1025078700 7:55964538-55964560 CCGGGGGAGGGGTCGCGCGGCGG + Intronic
1025106482 7:56175215-56175237 CCGGGGGTGGGGGGGGGCGGGGG + Intergenic
1025143267 7:56483365-56483387 CCGAGGGAAGGGGCGGGGCGAGG + Intergenic
1025198552 7:56948981-56949003 CCCGGGACAGGGGCGGGCTGGGG + Intergenic
1025227874 7:57179781-57179803 CCAGGGGAAGGAGCCTGCAGGGG + Intergenic
1025250396 7:57347827-57347849 CGGTGGGCAGGGGAGGGCAGAGG - Intergenic
1025673399 7:63627952-63627974 CCCGGGACAGGGGCGGGCTGGGG - Intergenic
1026218725 7:68372975-68372997 ACGGGGGAAAGGGTGGGAAGGGG - Intergenic
1026360783 7:69599452-69599474 AAGGGGGAAGGGGCGGAGAGAGG - Exonic
1026848832 7:73712363-73712385 CTGGGGGAAGTTGGGGGCAGAGG - Intronic
1026909357 7:74083587-74083609 AGGGCGGAAGGGGCGGGGAGGGG + Intronic
1027592569 7:80134782-80134804 GTGGTGGGAGGGGCGGGCAGGGG + Exonic
1028262193 7:88680116-88680138 TCGGGGGAAAGGGTGGGAAGGGG + Intergenic
1028832881 7:95345453-95345475 CTGGGGGTGGGGGCGGGTAGGGG + Intergenic
1028985645 7:97006499-97006521 CTGGGGGAGGGGGCCGGCGGAGG - Intronic
1029201431 7:98841864-98841886 CCGGGGGGCATGGCGGGCAGAGG - Intergenic
1029438397 7:100574776-100574798 GGGGGGGAAGGGGAGGGCACAGG + Exonic
1029449666 7:100633639-100633661 CCAGGGGCAGGGGCGGCGAGGGG + Intronic
1029551142 7:101237707-101237729 CCCGAGGAAGAGGCAGGCAGAGG - Exonic
1029644370 7:101844175-101844197 GCGGGGGCGGGGGCGGGGAGGGG - Intronic
1029737438 7:102472621-102472643 CCGCGGGATGGGGCGGGCAGGGG - Intronic
1029743090 7:102502283-102502305 CGGGGGGGAAGGGCGGGAAGGGG + Intronic
1029750450 7:102539847-102539869 CTGGGGGAAGGGGGTGGCTGGGG + Intronic
1029761080 7:102601444-102601466 CGGGGGGGAAGGGCGGGAAGGGG + Intronic
1029768402 7:102638955-102638977 CTGGGGGAAGGGGGTGGCTGGGG + Intronic
1030138739 7:106284676-106284698 CCCGGGGGAGGCGCGGGCGGCGG - Intronic
1030278351 7:107743841-107743863 ACCGGGGAAGGGGAGAGCAGTGG - Exonic
1030716723 7:112816263-112816285 GTGGGGGGAGGGGAGGGCAGTGG - Intergenic
1030820496 7:114086467-114086489 CCCGGGGAGGGGGGGGGCCGAGG - Intronic
1031001945 7:116425742-116425764 CCTGGGGAAGGGGTGGGGAGTGG - Intronic
1031980696 7:128122498-128122520 CCGGGGGGTGGGGGGGGCATTGG - Intergenic
1032013110 7:128359717-128359739 CCAGGGGAAGAGGTGGCCAGTGG - Exonic
1032054366 7:128672641-128672663 CCTGGGGGAGGGGGGGGCGGGGG + Intronic
1032298871 7:130668577-130668599 GCGGGGGAAGGGGCGTCCCGCGG + Intronic
1033031003 7:137826710-137826732 CAGGGGGAAGGGGGCGGCGGGGG + Intronic
1033040970 7:137917911-137917933 CTGGTGGAAGGGGAGGGCGGGGG + Intronic
1033099898 7:138460852-138460874 CCGGGGGCAGGGACGGGTGGCGG - Exonic
1033182477 7:139194421-139194443 CAGGGGGAAAGGGTGGGAAGGGG + Intergenic
1033226843 7:139569197-139569219 CAGGGGGAGGGGGCAGGCTGAGG + Exonic
1033280749 7:140004813-140004835 CCTGGGCTAGGGGTGGGCAGAGG + Intronic
1033389706 7:140914963-140914985 CCGGGGGGGGGGGGGGGCGGAGG + Intronic
1033661977 7:143408670-143408692 CCCCGGGAAGGGGCGGGGCGCGG + Intronic
1033842757 7:145395300-145395322 CTGGGGCAAGGGACAGGCAGTGG + Intergenic
1034270551 7:149801654-149801676 CAGGAGGAAGGGGAGGCCAGGGG + Intergenic
1034276634 7:149826707-149826729 CTGGGTGCAGGGGCAGGCAGTGG - Intergenic
1034339153 7:150341098-150341120 CCGGGGGAAGGGGCAGGGGCCGG + Exonic
1034990395 7:155544348-155544370 CCTGAGGAAGGGGCTGGAAGGGG - Intergenic
1035160583 7:156947565-156947587 CGGGGGGAAGCGGCGGGAAGCGG + Intergenic
1035167341 7:156999790-156999812 CCGCGGGCCGGGGCGGGCCGGGG - Intronic
1035242702 7:157542593-157542615 ATGGGGGAGGGGACGGGCAGGGG + Intronic
1035288246 7:157819731-157819753 GCGGGTGATGGGGCGTGCAGAGG - Intronic
1035435865 7:158858852-158858874 CAGGGGAAAGGGGAGGGGAGAGG - Intronic
1035435872 7:158858869-158858891 GAGGGGAAAGGGGAGGGCAGGGG - Intronic
1035477481 7:159153566-159153588 ACAGGGGAAGGAGGGGGCAGAGG - Intergenic
1035519684 8:266440-266462 CCTGGGGAGGGGGCGGCCGGGGG + Intergenic
1035623408 8:1052191-1052213 TGGGGGGAAGGGGTGGTCAGAGG - Intergenic
1035696463 8:1601468-1601490 CCGGGGGAAGGGGCGGCTGTGGG - Intronic
1036171445 8:6489306-6489328 CAGGGGGAAGGGGGAGGCAGGGG + Intronic
1036210321 8:6835514-6835536 GCAGGGGAAGGGGCGGGCGCAGG - Exonic
1036631973 8:10522222-10522244 CAGTGGGATGGGGCGGGCCGGGG - Intergenic
1037168929 8:15866335-15866357 CCAGGGGAAAGGGTGGGAAGGGG + Intergenic
1037707800 8:21330308-21330330 CTGGGGGGTGCGGCGGGCAGAGG + Intergenic
1037819954 8:22130733-22130755 CCGCGGGGAGGGCCGGGCCGGGG + Exonic
1038291177 8:26251216-26251238 CCGGGGGCAGGGGCGGGGGGGGG + Intergenic
1038424880 8:27458645-27458667 CCAGGGGTAGGGGTGGGGAGAGG - Exonic
1038542692 8:28402415-28402437 GCAGGGGAAGGGGCGGGGCGAGG + Intronic
1038612221 8:29068009-29068031 CCGAGGGAAGTGGCGGGGTGGGG + Exonic
1038936401 8:32256880-32256902 CCGGGGGAAGGGGCAGCTGGGGG - Intronic
1039084769 8:33768901-33768923 CGGGGGGAAAGGGTGGGAAGGGG + Intergenic
1039397777 8:37241745-37241767 TCGGGGGAAAGGGTGGGAAGGGG + Intergenic
1039453141 8:37691658-37691680 CCGGGGGATGGGGCAGACAGAGG + Intergenic
1039456510 8:37710972-37710994 ACTGGGGAAGGGGCAGGAAGGGG - Intergenic
1039702671 8:39978342-39978364 CGAGGGGAAGAGGCGAGCAGAGG + Intronic
1039907690 8:41798409-41798431 GCGTGGGATGGCGCGGGCAGGGG + Intronic
1040459222 8:47631010-47631032 CTGAGGGAAGAGGCAGGCAGAGG + Intronic
1040620993 8:49092792-49092814 GCGGGGGATGGGGGGGGCACAGG - Intergenic
1040687617 8:49894298-49894320 CAGGGGGAAAGGGTGGGAAGGGG - Intergenic
1040892420 8:52330972-52330994 ACAGGGGAAGGGGCAGGCAGAGG + Intronic
1041176999 8:55207236-55207258 CTGGGGGCAGGGTGGGGCAGTGG + Intronic
1041197021 8:55410648-55410670 CCCGGGGGAGAGGCAGGCAGGGG - Intronic
1041344585 8:56883495-56883517 CCAGGGGAAGGGGTGGGAGGCGG + Intergenic
1041642215 8:60215406-60215428 CAGGGGGAAAGGGTGGGAAGGGG + Intronic
1042591787 8:70403680-70403702 CCGGGGGAAGGCGCGGTTACCGG + Exonic
1042858993 8:73294857-73294879 CCCGGGGGAGGGGTGCGCAGCGG - Exonic
1043388410 8:79768913-79768935 CGGGGGGAGGGGGCGGGGGGGGG - Intergenic
1043877135 8:85498257-85498279 CAGGGGGAAAGGGTGGGAAGAGG + Intergenic
1044250655 8:90001366-90001388 CCGGGGGATGGGACGGGGACTGG - Intronic
1044904765 8:96989426-96989448 CGGAGGGAAGGGGAGGGGAGGGG + Intronic
1044932031 8:97260151-97260173 GAGGGGGAAGGGGAGGGGAGGGG + Intergenic
1045095486 8:98793171-98793193 CAGGGGGAAAGGGTGGGAAGCGG + Intronic
1045381678 8:101634008-101634030 CCGGGGGCAGGAGAGGTCAGCGG - Intronic
1045613473 8:103876594-103876616 CAGGGGGAAAGGGTGGGAAGGGG - Intronic
1045919423 8:107511866-107511888 GCGGGGGTAGGGGGTGGCAGAGG + Intergenic
1046646481 8:116791476-116791498 CTGGGGGAAAGGGTGGGAAGGGG - Intronic
1046973078 8:120244532-120244554 CCAGGGGAAAGGGTGGGAAGGGG - Intronic
1046982186 8:120348525-120348547 CAGGGGGAAAGGGTGGGAAGTGG + Intronic
1047611371 8:126523935-126523957 CAGGGGGAAAGGGTGGGAAGGGG + Intergenic
1048317911 8:133375551-133375573 GCTGGAGAAGGGGAGGGCAGTGG + Intergenic
1048374508 8:133811146-133811168 TCCGGGGAAAGGGCGGGAAGAGG + Intergenic
1049108772 8:140629876-140629898 CAGGGGGAAGAGGAGGGGAGGGG + Intronic
1049221637 8:141431318-141431340 GTGTGGGAGGGGGCGGGCAGAGG - Exonic
1049222962 8:141436202-141436224 CCCGGGGAAGGGAAGGGCTGGGG + Intergenic
1049240661 8:141535961-141535983 CGGTGGGGAGGGGCGGGGAGGGG + Intergenic
1049251954 8:141593966-141593988 CCCAAGGCAGGGGCGGGCAGGGG + Intergenic
1049276818 8:141724132-141724154 CCGGCGCCGGGGGCGGGCAGTGG - Intergenic
1049398901 8:142416096-142416118 CCGGGTGGTGGGGTGGGCAGGGG - Intergenic
1049440512 8:142607339-142607361 CAGGGGGGAGGGGAGGGGAGGGG + Intergenic
1049508990 8:143018459-143018481 GCGGGGGCAGGGGCGGGACGCGG - Intronic
1049588459 8:143442431-143442453 CCGGGGGGGGGGGGGGGCAGGGG + Intronic
1049673848 8:143881047-143881069 CCGGGGGCAGGGAAGGGCTGAGG + Intergenic
1049716274 8:144094676-144094698 CCGGCAGAGGGCGCGGGCAGGGG - Intergenic
1049789583 8:144466583-144466605 CCCGGGGCGGGGGCGGGCACGGG + Intronic
1050799785 9:9595788-9595810 CAGGGGGAAAGGGTGGGAAGGGG + Intronic
1051642710 9:19238519-19238541 GAGGGGGGAGGGGAGGGCAGGGG - Intronic
1052564340 9:30128426-30128448 CAGGGGGAAAGGGTGGGAAGGGG - Intergenic
1053142556 9:35690599-35690621 CCAGGGGCAGGGGCTGGGAGGGG - Exonic
1053669832 9:40348685-40348707 CCGGAGGAAGGAGCGGGCCGTGG + Intergenic
1053749445 9:41237102-41237124 CCGGTGGAAGGGGTGAGCAGGGG - Intergenic
1053919631 9:42974940-42974962 CCGGAGGAAGGAGCGGGCGGTGG + Intergenic
1054254888 9:62801982-62802004 CCGGTGGGAGGGGCGAGCAGGGG - Intergenic
1054336419 9:63813623-63813645 CCGGTGGAAGGGGCGAGCAGGGG + Intergenic
1054380964 9:64488686-64488708 CCGGAGGAAGGAGCGGGCAGTGG + Intergenic
1054514780 9:66027611-66027633 CCGGAGGAAGGAGCGGGCCGTGG - Intergenic
1054702059 9:68422871-68422893 ACGGGGGAAAGGGTGGGAAGGGG - Intronic
1054737561 9:68770751-68770773 CCATGGGATGGGGTGGGCAGTGG - Intronic
1055596191 9:77867160-77867182 CGGGGGGAAGTGGGGGCCAGGGG - Intronic
1055628800 9:78201461-78201483 CTGGGGGAAGGGGCGGCTATGGG + Intergenic
1055831775 9:80388068-80388090 CTGGGGGAAGGTGCTGTCAGAGG - Intergenic
1056170561 9:83980633-83980655 CTGGGGGGAGGGGCGGCTAGGGG + Intergenic
1056575881 9:87855988-87856010 CCGGTGGAAGGGACTGGGAGAGG + Intergenic
1056775697 9:89510974-89510996 CCAGGGACAGGGGAGGGCAGAGG - Intergenic
1057054542 9:91950307-91950329 CCGGGGGAACGCGCGGGCGGCGG + Intergenic
1057294325 9:93826609-93826631 GCGGAGGCAGGGGCGGGCGGGGG + Intergenic
1057909194 9:99004964-99004986 CCTGGGGAAGTGGAGGCCAGTGG + Exonic
1058112204 9:101043054-101043076 CAGGGGGAAAGGGTGGGAAGGGG - Intronic
1058467549 9:105244596-105244618 CAGCGGAAAGGGGCGGGCGGCGG - Intergenic
1059369131 9:113811138-113811160 TTGGGGGAAGGGGTGGGAAGTGG + Intergenic
1059659927 9:116390684-116390706 CGGGGGGCAGGGGGAGGCAGAGG - Intronic
1060202061 9:121657100-121657122 CAGGGGGCAGGGGCAGGCCGGGG - Intronic
1060967503 9:127720186-127720208 CTGGGAGAAGGGGCTGGCAGGGG - Intronic
1061182708 9:129034431-129034453 CCGTGGGGAGGGGAGGGAAGGGG - Intergenic
1061211998 9:129199023-129199045 CCGGGGGAGGGGGCGGGCTGGGG + Intergenic
1061236020 9:129343013-129343035 CCTGAGGAAGGGGCAGCCAGAGG + Intergenic
1061281720 9:129601440-129601462 CCGGGGGGAGGGACAAGCAGGGG + Intergenic
1061418036 9:130458597-130458619 ACCTGGGAAGGGCCGGGCAGAGG + Intronic
1061501927 9:131009086-131009108 CTGGAGGGAGGGGCGGGCGGCGG - Exonic
1061559509 9:131393891-131393913 CAGGGGGGAGGGGCGGGGAGCGG - Intergenic
1061580111 9:131531203-131531225 CCTGGGGAAGGGGCGGGCGCGGG - Intronic
1062042991 9:134412612-134412634 CCGGGACCAGGGGTGGGCAGAGG + Intronic
1062102871 9:134737657-134737679 CCTGGGGAAGGGGTCGGAAGTGG + Intronic
1062126094 9:134863900-134863922 GCGGGGGAAGGGGTGGGGATGGG - Intergenic
1062230653 9:135479942-135479964 CCGGGGGAGGCGGCGGGCCGGGG - Exonic
1062298383 9:135847899-135847921 GTGGGGGAAGGGGAGGGGAGTGG + Intronic
1062304321 9:135894352-135894374 CCGAGGGGAGGGGCGGACACCGG + Intronic
1062306000 9:135907420-135907442 CCGGGGGCGGGGGCGGGCGCGGG + Intergenic
1062351915 9:136143570-136143592 CCGGGGGCCGGGGTGGGGAGTGG + Intergenic
1062376432 9:136263931-136263953 CCGGCAGGAGGGGCGGGCAAAGG - Intergenic
1062403345 9:136382030-136382052 CCTGGGGATGAGGTGGGCAGGGG + Exonic
1062420054 9:136476328-136476350 CTGGGAGAAGGGCCTGGCAGAGG + Exonic
1062580654 9:137227923-137227945 CGGAGGGAAGGGGAGGGGAGGGG + Intronic
1062606586 9:137351243-137351265 CGGAGGGAAGGGTCAGGCAGGGG + Intronic
1203792415 EBV:158979-159001 CCGGGGGCAGGGCCTGGCCGGGG + Intergenic
1203442516 Un_GL000219v1:22600-22622 CCGGCGGCAGGTGCGGGAAGGGG + Intergenic
1203376355 Un_KI270442v1:381040-381062 CCGGGGGAAGGGGCGGGTAGGGG + Intergenic
1203513324 Un_KI270741v1:141509-141531 CCGGCGGCAGGTGCGGGAAGGGG + Intergenic
1185581271 X:1213040-1213062 GAGGGGGAAGGGGAGGGGAGAGG - Intergenic
1185581281 X:1213059-1213081 GAGGGGGAAGGGGAGGGGAGAGG - Intergenic
1185868701 X:3645264-3645286 CCGGGGGGAGGGGAGGGAGGAGG + Intronic
1186138687 X:6547958-6547980 CCAGGGAAAGGGCCTGGCAGTGG - Intergenic
1186348811 X:8722350-8722372 CCGGGGGAAAGGGTGGGAAGGGG - Intronic
1186576571 X:10772405-10772427 CAGGGGGAAAGGGTGGGAAGGGG + Intronic
1187166058 X:16804962-16804984 CGGGGGGGGGGGGTGGGCAGTGG - Intronic
1187332525 X:18354233-18354255 CCGTGGGTAGGGCCGGGCTGGGG - Intronic
1187390897 X:18886119-18886141 TCGGGGGATGGGGTGGGCAAAGG - Intergenic
1187600011 X:20818745-20818767 TCGGGGGAAAGGGCAGGAAGGGG + Intergenic
1188004471 X:25007496-25007518 CCAAGGGAAGGGACGGGTAGGGG - Intronic
1188039963 X:25360366-25360388 CAGGGGGAAAGGACGGGAAGGGG - Intergenic
1188212786 X:27444012-27444034 CCGGGGGGAGGGAAGGGGAGGGG + Intergenic
1189360555 X:40347347-40347369 CGGGGGGAAAGGGTGGGAAGGGG + Intergenic
1189377099 X:40474651-40474673 CGGGCGGGGGGGGCGGGCAGAGG + Intergenic
1189733456 X:44045879-44045901 CCGGGGGAAAGGGTGGGAAGAGG - Intergenic
1189915489 X:45851611-45851633 CGGCGGGGATGGGCGGGCAGGGG - Intergenic
1190911319 X:54774846-54774868 CTGAGGGAAGGGGAGGGGAGGGG + Intronic
1192207291 X:69105006-69105028 CAGGGGGAGGGGGCCGGCAGGGG + Intergenic
1192212504 X:69136925-69136947 CCTGGGGATGGGGAGGGGAGGGG - Intergenic
1192234237 X:69285866-69285888 CAAGGGAAAGGGGTGGGCAGAGG + Intergenic
1192399037 X:70816074-70816096 CAGGGGGAAAGGGTGGGAAGGGG - Intronic
1192419953 X:71020820-71020842 CAGGGGGAAAGGGTGGGAAGGGG - Intergenic
1192428265 X:71096035-71096057 GCGGGGGAAGGGGGAGTCAGGGG + Intergenic
1192541313 X:71975576-71975598 CCAGGGGAAGGGGCAGGGAATGG - Intergenic
1192561738 X:72131850-72131872 CCGGGCGGGCGGGCGGGCAGGGG + Intronic
1192611636 X:72572730-72572752 CCGGAGGAACCGGCGGACAGTGG - Exonic
1192951548 X:76022875-76022897 TCGGGGGAAAGGGTGGGAAGGGG + Intergenic
1192964226 X:76159862-76159884 CTGGGGGAAGGGGCGGTTGGGGG + Intergenic
1193130367 X:77913401-77913423 CCGGGGCAAGGGGGAGGCTGGGG + Intronic
1193136359 X:77975242-77975264 CAAGGGAAAGGGGCGGGCAGGGG - Intronic
1193221020 X:78927192-78927214 CTGGGGGAAAGGGTGGGAAGAGG + Intergenic
1193253973 X:79325258-79325280 CTGGGGGAAAGGGGGGGCTGTGG - Intergenic
1193949383 X:87778958-87778980 CTGGGGGAAGGGGGCGGCTGTGG + Intergenic
1194268718 X:91783324-91783346 CAGGGGGAAGGGGCAGGGAGTGG - Intronic
1194527879 X:95001984-95002006 CAGGGGGAAAGGGTGGGAAGAGG - Intergenic
1195065486 X:101235007-101235029 CAGGGGGCAGGAGCAGGCAGAGG - Intronic
1195157936 X:102141971-102141993 CCGGGGGAAGGGGCACAAAGAGG - Intronic
1195668315 X:107449819-107449841 CCGGGCGGCGGGGCGGGCAGAGG - Intergenic
1196031508 X:111098637-111098659 CCTGGGTAAGGAGAGGGCAGTGG + Intronic
1196269748 X:113697504-113697526 CTGGGGGAAGGGGCGGTTGGGGG - Intergenic
1196340028 X:114584710-114584732 GCGGGGGATGGGGTGGGGAGCGG + Intronic
1196616166 X:117769299-117769321 CGGGGGGCAGGGGGGGGGAGGGG - Intergenic
1196816468 X:119668931-119668953 CAGGGGGAAAGGGCGGGAAGGGG - Intronic
1196833520 X:119794570-119794592 CTTGGGGCAGGGGTGGGCAGGGG - Intergenic
1197061804 X:122190409-122190431 CCGGGAGCAGTGGCAGGCAGGGG - Intergenic
1197145793 X:123170883-123170905 GTGGGGGAGGGGGAGGGCAGGGG - Intergenic
1198543135 X:137661744-137661766 CCGTGGGAAGGCGCACGCAGAGG + Intergenic
1199265402 X:145821462-145821484 ACGGGGGAGGGGGCAGGCAGAGG - Exonic
1199765932 X:150941726-150941748 CTGGGGGAGGGGGAAGGCAGAGG + Intergenic
1200100785 X:153688420-153688442 CCGGGGGACGGGGCGGCGGGCGG - Exonic
1200101070 X:153689268-153689290 GCGAGGGGAGGGGAGGGCAGGGG - Intronic
1200120336 X:153787205-153787227 CAGAGGGACGGGGCGTGCAGAGG + Intronic
1200585920 Y:5004240-5004262 CAGGGGGAAGGGGCAGGGAGTGG - Intronic
1201065699 Y:10092520-10092542 CCGGGGGAAGGGGCGGGCAGGGG - Intergenic
1201763264 Y:17560204-17560226 GCTGGGGAAGGGGTGGGCAGGGG + Intergenic
1201838289 Y:18345786-18345808 GCTGGGGAAGGGGTGGGCAGGGG - Intergenic