ID: 922838870

View in Genome Browser
Species Human (GRCh38)
Location 1:228636397-228636419
Sequence ACCGGGGGAAGGGGCGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922838870_922838885 7 Left 922838870 1:228636397-228636419 CCCTGCCCGCCCCTTCCCCCGGT No data
Right 922838885 1:228636427-228636449 GGTGCGACGACGGCGCCCGATGG No data
922838870_922838884 -3 Left 922838870 1:228636397-228636419 CCCTGCCCGCCCCTTCCCCCGGT No data
Right 922838884 1:228636417-228636439 GGTTTGGAAGGGTGCGACGACGG No data
922838870_922838890 26 Left 922838870 1:228636397-228636419 CCCTGCCCGCCCCTTCCCCCGGT No data
Right 922838890 1:228636446-228636468 ATGGGTGAATTGAATCACCTGGG No data
922838870_922838886 8 Left 922838870 1:228636397-228636419 CCCTGCCCGCCCCTTCCCCCGGT No data
Right 922838886 1:228636428-228636450 GTGCGACGACGGCGCCCGATGGG No data
922838870_922838889 25 Left 922838870 1:228636397-228636419 CCCTGCCCGCCCCTTCCCCCGGT No data
Right 922838889 1:228636445-228636467 GATGGGTGAATTGAATCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922838870 Original CRISPR ACCGGGGGAAGGGGCGGGCA GGG (reversed) Intergenic
No off target data available for this crispr