ID: 922838876

View in Genome Browser
Species Human (GRCh38)
Location 1:228636406-228636428
Sequence CCCTTCCAAACCGGGGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922838876_922838890 17 Left 922838876 1:228636406-228636428 CCCCTTCCCCCGGTTTGGAAGGG No data
Right 922838890 1:228636446-228636468 ATGGGTGAATTGAATCACCTGGG No data
922838876_922838885 -2 Left 922838876 1:228636406-228636428 CCCCTTCCCCCGGTTTGGAAGGG No data
Right 922838885 1:228636427-228636449 GGTGCGACGACGGCGCCCGATGG No data
922838876_922838889 16 Left 922838876 1:228636406-228636428 CCCCTTCCCCCGGTTTGGAAGGG No data
Right 922838889 1:228636445-228636467 GATGGGTGAATTGAATCACCTGG No data
922838876_922838891 25 Left 922838876 1:228636406-228636428 CCCCTTCCCCCGGTTTGGAAGGG No data
Right 922838891 1:228636454-228636476 ATTGAATCACCTGGGCGTTCCGG No data
922838876_922838886 -1 Left 922838876 1:228636406-228636428 CCCCTTCCCCCGGTTTGGAAGGG No data
Right 922838886 1:228636428-228636450 GTGCGACGACGGCGCCCGATGGG No data
922838876_922838892 26 Left 922838876 1:228636406-228636428 CCCCTTCCCCCGGTTTGGAAGGG No data
Right 922838892 1:228636455-228636477 TTGAATCACCTGGGCGTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922838876 Original CRISPR CCCTTCCAAACCGGGGGAAG GGG (reversed) Intergenic
No off target data available for this crispr