ID: 922838877

View in Genome Browser
Species Human (GRCh38)
Location 1:228636406-228636428
Sequence CCCCTTCCCCCGGTTTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922838864_922838877 21 Left 922838864 1:228636362-228636384 CCGACGTCTTGGCTGGCGTCTGT No data
Right 922838877 1:228636406-228636428 CCCCTTCCCCCGGTTTGGAAGGG No data
922838866_922838877 -6 Left 922838866 1:228636389-228636411 CCCGCTGCCCCTGCCCGCCCCTT No data
Right 922838877 1:228636406-228636428 CCCCTTCCCCCGGTTTGGAAGGG No data
922838867_922838877 -7 Left 922838867 1:228636390-228636412 CCGCTGCCCCTGCCCGCCCCTTC No data
Right 922838877 1:228636406-228636428 CCCCTTCCCCCGGTTTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922838877 Original CRISPR CCCCTTCCCCCGGTTTGGAA GGG Intergenic
No off target data available for this crispr