ID: 922838881

View in Genome Browser
Species Human (GRCh38)
Location 1:228636413-228636435
Sequence CGTCGCACCCTTCCAAACCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922838881_922838892 19 Left 922838881 1:228636413-228636435 CCCCGGTTTGGAAGGGTGCGACG No data
Right 922838892 1:228636455-228636477 TTGAATCACCTGGGCGTTCCGGG No data
922838881_922838896 29 Left 922838881 1:228636413-228636435 CCCCGGTTTGGAAGGGTGCGACG No data
Right 922838896 1:228636465-228636487 TGGGCGTTCCGGGAGCGGGAAGG No data
922838881_922838893 24 Left 922838881 1:228636413-228636435 CCCCGGTTTGGAAGGGTGCGACG No data
Right 922838893 1:228636460-228636482 TCACCTGGGCGTTCCGGGAGCGG No data
922838881_922838885 -9 Left 922838881 1:228636413-228636435 CCCCGGTTTGGAAGGGTGCGACG No data
Right 922838885 1:228636427-228636449 GGTGCGACGACGGCGCCCGATGG No data
922838881_922838890 10 Left 922838881 1:228636413-228636435 CCCCGGTTTGGAAGGGTGCGACG No data
Right 922838890 1:228636446-228636468 ATGGGTGAATTGAATCACCTGGG No data
922838881_922838894 25 Left 922838881 1:228636413-228636435 CCCCGGTTTGGAAGGGTGCGACG No data
Right 922838894 1:228636461-228636483 CACCTGGGCGTTCCGGGAGCGGG No data
922838881_922838889 9 Left 922838881 1:228636413-228636435 CCCCGGTTTGGAAGGGTGCGACG No data
Right 922838889 1:228636445-228636467 GATGGGTGAATTGAATCACCTGG No data
922838881_922838891 18 Left 922838881 1:228636413-228636435 CCCCGGTTTGGAAGGGTGCGACG No data
Right 922838891 1:228636454-228636476 ATTGAATCACCTGGGCGTTCCGG No data
922838881_922838886 -8 Left 922838881 1:228636413-228636435 CCCCGGTTTGGAAGGGTGCGACG No data
Right 922838886 1:228636428-228636450 GTGCGACGACGGCGCCCGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922838881 Original CRISPR CGTCGCACCCTTCCAAACCG GGG (reversed) Intergenic
No off target data available for this crispr