ID: 922838883

View in Genome Browser
Species Human (GRCh38)
Location 1:228636415-228636437
Sequence GTCGTCGCACCCTTCCAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922838883_922838886 -10 Left 922838883 1:228636415-228636437 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922838886 1:228636428-228636450 GTGCGACGACGGCGCCCGATGGG No data
922838883_922838896 27 Left 922838883 1:228636415-228636437 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922838896 1:228636465-228636487 TGGGCGTTCCGGGAGCGGGAAGG No data
922838883_922838893 22 Left 922838883 1:228636415-228636437 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922838893 1:228636460-228636482 TCACCTGGGCGTTCCGGGAGCGG No data
922838883_922838894 23 Left 922838883 1:228636415-228636437 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922838894 1:228636461-228636483 CACCTGGGCGTTCCGGGAGCGGG No data
922838883_922838892 17 Left 922838883 1:228636415-228636437 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922838892 1:228636455-228636477 TTGAATCACCTGGGCGTTCCGGG No data
922838883_922838889 7 Left 922838883 1:228636415-228636437 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922838889 1:228636445-228636467 GATGGGTGAATTGAATCACCTGG No data
922838883_922838890 8 Left 922838883 1:228636415-228636437 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922838890 1:228636446-228636468 ATGGGTGAATTGAATCACCTGGG No data
922838883_922838891 16 Left 922838883 1:228636415-228636437 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922838891 1:228636454-228636476 ATTGAATCACCTGGGCGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922838883 Original CRISPR GTCGTCGCACCCTTCCAAAC CGG (reversed) Intergenic
No off target data available for this crispr