ID: 922838884

View in Genome Browser
Species Human (GRCh38)
Location 1:228636417-228636439
Sequence GGTTTGGAAGGGTGCGACGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922838874_922838884 -9 Left 922838874 1:228636403-228636425 CCGCCCCTTCCCCCGGTTTGGAA No data
Right 922838884 1:228636417-228636439 GGTTTGGAAGGGTGCGACGACGG No data
922838868_922838884 -2 Left 922838868 1:228636396-228636418 CCCCTGCCCGCCCCTTCCCCCGG 0: 22
1: 4
2: 8
3: 139
4: 1138
Right 922838884 1:228636417-228636439 GGTTTGGAAGGGTGCGACGACGG No data
922838870_922838884 -3 Left 922838870 1:228636397-228636419 CCCTGCCCGCCCCTTCCCCCGGT No data
Right 922838884 1:228636417-228636439 GGTTTGGAAGGGTGCGACGACGG No data
922838873_922838884 -8 Left 922838873 1:228636402-228636424 CCCGCCCCTTCCCCCGGTTTGGA No data
Right 922838884 1:228636417-228636439 GGTTTGGAAGGGTGCGACGACGG No data
922838871_922838884 -4 Left 922838871 1:228636398-228636420 CCTGCCCGCCCCTTCCCCCGGTT No data
Right 922838884 1:228636417-228636439 GGTTTGGAAGGGTGCGACGACGG No data
922838867_922838884 4 Left 922838867 1:228636390-228636412 CCGCTGCCCCTGCCCGCCCCTTC No data
Right 922838884 1:228636417-228636439 GGTTTGGAAGGGTGCGACGACGG No data
922838866_922838884 5 Left 922838866 1:228636389-228636411 CCCGCTGCCCCTGCCCGCCCCTT No data
Right 922838884 1:228636417-228636439 GGTTTGGAAGGGTGCGACGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922838884 Original CRISPR GGTTTGGAAGGGTGCGACGA CGG Intergenic
No off target data available for this crispr