ID: 922838886

View in Genome Browser
Species Human (GRCh38)
Location 1:228636428-228636450
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922838876_922838886 -1 Left 922838876 1:228636406-228636428 CCCCTTCCCCCGGTTTGGAAGGG No data
Right 922838886 1:228636428-228636450 GTGCGACGACGGCGCCCGATGGG No data
922838867_922838886 15 Left 922838867 1:228636390-228636412 CCGCTGCCCCTGCCCGCCCCTTC No data
Right 922838886 1:228636428-228636450 GTGCGACGACGGCGCCCGATGGG No data
922838881_922838886 -8 Left 922838881 1:228636413-228636435 CCCCGGTTTGGAAGGGTGCGACG No data
Right 922838886 1:228636428-228636450 GTGCGACGACGGCGCCCGATGGG No data
922838873_922838886 3 Left 922838873 1:228636402-228636424 CCCGCCCCTTCCCCCGGTTTGGA No data
Right 922838886 1:228636428-228636450 GTGCGACGACGGCGCCCGATGGG No data
922838882_922838886 -9 Left 922838882 1:228636414-228636436 CCCGGTTTGGAAGGGTGCGACGA No data
Right 922838886 1:228636428-228636450 GTGCGACGACGGCGCCCGATGGG No data
922838868_922838886 9 Left 922838868 1:228636396-228636418 CCCCTGCCCGCCCCTTCCCCCGG 0: 22
1: 4
2: 8
3: 139
4: 1138
Right 922838886 1:228636428-228636450 GTGCGACGACGGCGCCCGATGGG No data
922838880_922838886 -7 Left 922838880 1:228636412-228636434 CCCCCGGTTTGGAAGGGTGCGAC No data
Right 922838886 1:228636428-228636450 GTGCGACGACGGCGCCCGATGGG No data
922838866_922838886 16 Left 922838866 1:228636389-228636411 CCCGCTGCCCCTGCCCGCCCCTT No data
Right 922838886 1:228636428-228636450 GTGCGACGACGGCGCCCGATGGG No data
922838879_922838886 -3 Left 922838879 1:228636408-228636430 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922838886 1:228636428-228636450 GTGCGACGACGGCGCCCGATGGG No data
922838874_922838886 2 Left 922838874 1:228636403-228636425 CCGCCCCTTCCCCCGGTTTGGAA No data
Right 922838886 1:228636428-228636450 GTGCGACGACGGCGCCCGATGGG No data
922838883_922838886 -10 Left 922838883 1:228636415-228636437 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922838886 1:228636428-228636450 GTGCGACGACGGCGCCCGATGGG No data
922838871_922838886 7 Left 922838871 1:228636398-228636420 CCTGCCCGCCCCTTCCCCCGGTT No data
Right 922838886 1:228636428-228636450 GTGCGACGACGGCGCCCGATGGG No data
922838878_922838886 -2 Left 922838878 1:228636407-228636429 CCCTTCCCCCGGTTTGGAAGGGT No data
Right 922838886 1:228636428-228636450 GTGCGACGACGGCGCCCGATGGG No data
922838870_922838886 8 Left 922838870 1:228636397-228636419 CCCTGCCCGCCCCTTCCCCCGGT No data
Right 922838886 1:228636428-228636450 GTGCGACGACGGCGCCCGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr