ID: 922838887

View in Genome Browser
Species Human (GRCh38)
Location 1:228636442-228636464
Sequence GGTGATTCAATTCACCCATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922838887_922838896 0 Left 922838887 1:228636442-228636464 CCCGATGGGTGAATTGAATCACC No data
Right 922838896 1:228636465-228636487 TGGGCGTTCCGGGAGCGGGAAGG No data
922838887_922838892 -10 Left 922838887 1:228636442-228636464 CCCGATGGGTGAATTGAATCACC No data
Right 922838892 1:228636455-228636477 TTGAATCACCTGGGCGTTCCGGG No data
922838887_922838894 -4 Left 922838887 1:228636442-228636464 CCCGATGGGTGAATTGAATCACC No data
Right 922838894 1:228636461-228636483 CACCTGGGCGTTCCGGGAGCGGG No data
922838887_922838899 16 Left 922838887 1:228636442-228636464 CCCGATGGGTGAATTGAATCACC No data
Right 922838899 1:228636481-228636503 GGGAAGGCACCGCGAACGGCAGG No data
922838887_922838900 17 Left 922838887 1:228636442-228636464 CCCGATGGGTGAATTGAATCACC No data
Right 922838900 1:228636482-228636504 GGAAGGCACCGCGAACGGCAGGG No data
922838887_922838902 27 Left 922838887 1:228636442-228636464 CCCGATGGGTGAATTGAATCACC No data
Right 922838902 1:228636492-228636514 GCGAACGGCAGGGAACCCAGCGG No data
922838887_922838893 -5 Left 922838887 1:228636442-228636464 CCCGATGGGTGAATTGAATCACC No data
Right 922838893 1:228636460-228636482 TCACCTGGGCGTTCCGGGAGCGG No data
922838887_922838898 12 Left 922838887 1:228636442-228636464 CCCGATGGGTGAATTGAATCACC No data
Right 922838898 1:228636477-228636499 GAGCGGGAAGGCACCGCGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922838887 Original CRISPR GGTGATTCAATTCACCCATC GGG (reversed) Intergenic
No off target data available for this crispr