ID: 922838892

View in Genome Browser
Species Human (GRCh38)
Location 1:228636455-228636477
Sequence TTGAATCACCTGGGCGTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922838876_922838892 26 Left 922838876 1:228636406-228636428 CCCCTTCCCCCGGTTTGGAAGGG No data
Right 922838892 1:228636455-228636477 TTGAATCACCTGGGCGTTCCGGG No data
922838887_922838892 -10 Left 922838887 1:228636442-228636464 CCCGATGGGTGAATTGAATCACC No data
Right 922838892 1:228636455-228636477 TTGAATCACCTGGGCGTTCCGGG No data
922838879_922838892 24 Left 922838879 1:228636408-228636430 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922838892 1:228636455-228636477 TTGAATCACCTGGGCGTTCCGGG No data
922838873_922838892 30 Left 922838873 1:228636402-228636424 CCCGCCCCTTCCCCCGGTTTGGA No data
Right 922838892 1:228636455-228636477 TTGAATCACCTGGGCGTTCCGGG No data
922838882_922838892 18 Left 922838882 1:228636414-228636436 CCCGGTTTGGAAGGGTGCGACGA No data
Right 922838892 1:228636455-228636477 TTGAATCACCTGGGCGTTCCGGG No data
922838874_922838892 29 Left 922838874 1:228636403-228636425 CCGCCCCTTCCCCCGGTTTGGAA No data
Right 922838892 1:228636455-228636477 TTGAATCACCTGGGCGTTCCGGG No data
922838881_922838892 19 Left 922838881 1:228636413-228636435 CCCCGGTTTGGAAGGGTGCGACG No data
Right 922838892 1:228636455-228636477 TTGAATCACCTGGGCGTTCCGGG No data
922838878_922838892 25 Left 922838878 1:228636407-228636429 CCCTTCCCCCGGTTTGGAAGGGT No data
Right 922838892 1:228636455-228636477 TTGAATCACCTGGGCGTTCCGGG No data
922838883_922838892 17 Left 922838883 1:228636415-228636437 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922838892 1:228636455-228636477 TTGAATCACCTGGGCGTTCCGGG No data
922838880_922838892 20 Left 922838880 1:228636412-228636434 CCCCCGGTTTGGAAGGGTGCGAC No data
Right 922838892 1:228636455-228636477 TTGAATCACCTGGGCGTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922838892 Original CRISPR TTGAATCACCTGGGCGTTCC GGG Intergenic
No off target data available for this crispr