ID: 922838894

View in Genome Browser
Species Human (GRCh38)
Location 1:228636461-228636483
Sequence CACCTGGGCGTTCCGGGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922838882_922838894 24 Left 922838882 1:228636414-228636436 CCCGGTTTGGAAGGGTGCGACGA No data
Right 922838894 1:228636461-228636483 CACCTGGGCGTTCCGGGAGCGGG No data
922838887_922838894 -4 Left 922838887 1:228636442-228636464 CCCGATGGGTGAATTGAATCACC No data
Right 922838894 1:228636461-228636483 CACCTGGGCGTTCCGGGAGCGGG No data
922838881_922838894 25 Left 922838881 1:228636413-228636435 CCCCGGTTTGGAAGGGTGCGACG No data
Right 922838894 1:228636461-228636483 CACCTGGGCGTTCCGGGAGCGGG No data
922838880_922838894 26 Left 922838880 1:228636412-228636434 CCCCCGGTTTGGAAGGGTGCGAC No data
Right 922838894 1:228636461-228636483 CACCTGGGCGTTCCGGGAGCGGG No data
922838879_922838894 30 Left 922838879 1:228636408-228636430 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922838894 1:228636461-228636483 CACCTGGGCGTTCCGGGAGCGGG No data
922838888_922838894 -5 Left 922838888 1:228636443-228636465 CCGATGGGTGAATTGAATCACCT No data
Right 922838894 1:228636461-228636483 CACCTGGGCGTTCCGGGAGCGGG No data
922838883_922838894 23 Left 922838883 1:228636415-228636437 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922838894 1:228636461-228636483 CACCTGGGCGTTCCGGGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922838894 Original CRISPR CACCTGGGCGTTCCGGGAGC GGG Intergenic
No off target data available for this crispr