ID: 922839383

View in Genome Browser
Species Human (GRCh38)
Location 1:228638441-228638463
Sequence CCGGGCGGGCCCGGAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922839364_922839383 24 Left 922839364 1:228638394-228638416 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922839383 1:228638441-228638463 CCGGGCGGGCCCGGAGGCCTGGG No data
922839369_922839383 4 Left 922839369 1:228638414-228638436 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922839383 1:228638441-228638463 CCGGGCGGGCCCGGAGGCCTGGG No data
922839370_922839383 3 Left 922839370 1:228638415-228638437 CCGCCCGTTTGGCGGGAGCCGTG No data
Right 922839383 1:228638441-228638463 CCGGGCGGGCCCGGAGGCCTGGG No data
922839363_922839383 25 Left 922839363 1:228638393-228638415 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922839383 1:228638441-228638463 CCGGGCGGGCCCGGAGGCCTGGG No data
922839372_922839383 0 Left 922839372 1:228638418-228638440 CCCGTTTGGCGGGAGCCGTGGCA No data
Right 922839383 1:228638441-228638463 CCGGGCGGGCCCGGAGGCCTGGG No data
922839365_922839383 23 Left 922839365 1:228638395-228638417 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922839383 1:228638441-228638463 CCGGGCGGGCCCGGAGGCCTGGG No data
922839373_922839383 -1 Left 922839373 1:228638419-228638441 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922839383 1:228638441-228638463 CCGGGCGGGCCCGGAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922839383 Original CRISPR CCGGGCGGGCCCGGAGGCCT GGG Intergenic
No off target data available for this crispr