ID: 922839439

View in Genome Browser
Species Human (GRCh38)
Location 1:228638649-228638671
Sequence CACCCTTCCAAACCGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922839439_922839449 14 Left 922839439 1:228638649-228638671 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922839449 1:228638686-228638708 GATGGGTGAATTGAATCGCCTGG No data
922839439_922839450 15 Left 922839439 1:228638649-228638671 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922839450 1:228638687-228638709 ATGGGTGAATTGAATCGCCTGGG No data
922839439_922839454 30 Left 922839439 1:228638649-228638671 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922839454 1:228638702-228638724 CGCCTGGGCGTTCCGGGAGCGGG No data
922839439_922839445 -4 Left 922839439 1:228638649-228638671 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922839445 1:228638668-228638690 GGTGCGACGACGGCGCCCGATGG No data
922839439_922839446 -3 Left 922839439 1:228638649-228638671 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922839446 1:228638669-228638691 GTGCGACGACGGCGCCCGATGGG No data
922839439_922839453 29 Left 922839439 1:228638649-228638671 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922839453 1:228638701-228638723 TCGCCTGGGCGTTCCGGGAGCGG No data
922839439_922839451 23 Left 922839439 1:228638649-228638671 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922839451 1:228638695-228638717 ATTGAATCGCCTGGGCGTTCCGG No data
922839439_922839452 24 Left 922839439 1:228638649-228638671 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922839452 1:228638696-228638718 TTGAATCGCCTGGGCGTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922839439 Original CRISPR CACCCTTCCAAACCGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr