ID: 922840000

View in Genome Browser
Species Human (GRCh38)
Location 1:228640880-228640902
Sequence CACCCTTCCAAACCGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922840000_922840012 23 Left 922840000 1:228640880-228640902 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922840012 1:228640926-228640948 ATTGAATCGCCTGGGCGTTCCGG No data
922840000_922840015 30 Left 922840000 1:228640880-228640902 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922840015 1:228640933-228640955 CGCCTGGGCGTTCCGGGAGCGGG No data
922840000_922840014 29 Left 922840000 1:228640880-228640902 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922840014 1:228640932-228640954 TCGCCTGGGCGTTCCGGGAGCGG No data
922840000_922840011 15 Left 922840000 1:228640880-228640902 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922840011 1:228640918-228640940 ATGGGTGAATTGAATCGCCTGGG No data
922840000_922840007 -3 Left 922840000 1:228640880-228640902 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922840007 1:228640900-228640922 GTGCGACGACGGCGCCCGATGGG No data
922840000_922840013 24 Left 922840000 1:228640880-228640902 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922840013 1:228640927-228640949 TTGAATCGCCTGGGCGTTCCGGG No data
922840000_922840010 14 Left 922840000 1:228640880-228640902 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922840010 1:228640917-228640939 GATGGGTGAATTGAATCGCCTGG No data
922840000_922840006 -4 Left 922840000 1:228640880-228640902 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922840006 1:228640899-228640921 GGTGCGACGACGGCGCCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922840000 Original CRISPR CACCCTTCCAAACCGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr