ID: 922840504

View in Genome Browser
Species Human (GRCh38)
Location 1:228642913-228642935
Sequence CCGGGCGGGCCCGGAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922840491_922840504 3 Left 922840491 1:228642887-228642909 CCGCCCGTTTGGCGGGAGCCGTG No data
Right 922840504 1:228642913-228642935 CCGGGCGGGCCCGGAGGCCTGGG No data
922840486_922840504 23 Left 922840486 1:228642867-228642889 CCGAGATTTGCAGAGCGCGCCCG No data
Right 922840504 1:228642913-228642935 CCGGGCGGGCCCGGAGGCCTGGG No data
922840485_922840504 24 Left 922840485 1:228642866-228642888 CCCGAGATTTGCAGAGCGCGCCC No data
Right 922840504 1:228642913-228642935 CCGGGCGGGCCCGGAGGCCTGGG No data
922840494_922840504 -1 Left 922840494 1:228642891-228642913 CCGTTTGGCGGGAGCCGTGGCAC No data
Right 922840504 1:228642913-228642935 CCGGGCGGGCCCGGAGGCCTGGG No data
922840490_922840504 4 Left 922840490 1:228642886-228642908 CCCGCCCGTTTGGCGGGAGCCGT No data
Right 922840504 1:228642913-228642935 CCGGGCGGGCCCGGAGGCCTGGG No data
922840493_922840504 0 Left 922840493 1:228642890-228642912 CCCGTTTGGCGGGAGCCGTGGCA No data
Right 922840504 1:228642913-228642935 CCGGGCGGGCCCGGAGGCCTGGG No data
922840484_922840504 25 Left 922840484 1:228642865-228642887 CCCCGAGATTTGCAGAGCGCGCC No data
Right 922840504 1:228642913-228642935 CCGGGCGGGCCCGGAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922840504 Original CRISPR CCGGGCGGGCCCGGAGGCCT GGG Intergenic
No off target data available for this crispr