ID: 922840560

View in Genome Browser
Species Human (GRCh38)
Location 1:228643121-228643143
Sequence CACCCTTCCAAACCGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922840560_922840567 -3 Left 922840560 1:228643121-228643143 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922840567 1:228643141-228643163 GTGCGACGACGGCGCCCGATGGG No data
922840560_922840574 29 Left 922840560 1:228643121-228643143 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922840574 1:228643173-228643195 TCGCCTGGGCGTTCCGGGAGCGG No data
922840560_922840575 30 Left 922840560 1:228643121-228643143 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922840575 1:228643174-228643196 CGCCTGGGCGTTCCGGGAGCGGG No data
922840560_922840571 15 Left 922840560 1:228643121-228643143 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922840571 1:228643159-228643181 ATGGGTGAATTGAATCGCCTGGG No data
922840560_922840573 24 Left 922840560 1:228643121-228643143 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922840573 1:228643168-228643190 TTGAATCGCCTGGGCGTTCCGGG No data
922840560_922840570 14 Left 922840560 1:228643121-228643143 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922840570 1:228643158-228643180 GATGGGTGAATTGAATCGCCTGG No data
922840560_922840566 -4 Left 922840560 1:228643121-228643143 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922840566 1:228643140-228643162 GGTGCGACGACGGCGCCCGATGG No data
922840560_922840572 23 Left 922840560 1:228643121-228643143 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922840572 1:228643167-228643189 ATTGAATCGCCTGGGCGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922840560 Original CRISPR CACCCTTCCAAACCGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr