ID: 922841123

View in Genome Browser
Species Human (GRCh38)
Location 1:228645352-228645374
Sequence CACCCTTCCAAACCGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922841123_922841136 24 Left 922841123 1:228645352-228645374 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922841136 1:228645399-228645421 TTGAATCGCCTGGGCGTTCCGGG No data
922841123_922841129 -4 Left 922841123 1:228645352-228645374 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922841129 1:228645371-228645393 GGTGCGACGACGGCGCCCGATGG No data
922841123_922841133 14 Left 922841123 1:228645352-228645374 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922841133 1:228645389-228645411 GATGGGTGAATTGAATCGCCTGG No data
922841123_922841134 15 Left 922841123 1:228645352-228645374 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922841134 1:228645390-228645412 ATGGGTGAATTGAATCGCCTGGG No data
922841123_922841135 23 Left 922841123 1:228645352-228645374 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922841135 1:228645398-228645420 ATTGAATCGCCTGGGCGTTCCGG No data
922841123_922841130 -3 Left 922841123 1:228645352-228645374 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922841130 1:228645372-228645394 GTGCGACGACGGCGCCCGATGGG No data
922841123_922841138 30 Left 922841123 1:228645352-228645374 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922841138 1:228645405-228645427 CGCCTGGGCGTTCCGGGAGCGGG No data
922841123_922841137 29 Left 922841123 1:228645352-228645374 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922841137 1:228645404-228645426 TCGCCTGGGCGTTCCGGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922841123 Original CRISPR CACCCTTCCAAACCGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr