ID: 922841124

View in Genome Browser
Species Human (GRCh38)
Location 1:228645356-228645378
Sequence GTCGCACCCTTCCAAACCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922841124_922841133 10 Left 922841124 1:228645356-228645378 CCCCCGGTTTGGAAGGGTGCGAC No data
Right 922841133 1:228645389-228645411 GATGGGTGAATTGAATCGCCTGG No data
922841124_922841129 -8 Left 922841124 1:228645356-228645378 CCCCCGGTTTGGAAGGGTGCGAC No data
Right 922841129 1:228645371-228645393 GGTGCGACGACGGCGCCCGATGG No data
922841124_922841130 -7 Left 922841124 1:228645356-228645378 CCCCCGGTTTGGAAGGGTGCGAC No data
Right 922841130 1:228645372-228645394 GTGCGACGACGGCGCCCGATGGG No data
922841124_922841140 30 Left 922841124 1:228645356-228645378 CCCCCGGTTTGGAAGGGTGCGAC No data
Right 922841140 1:228645409-228645431 TGGGCGTTCCGGGAGCGGGAAGG No data
922841124_922841137 25 Left 922841124 1:228645356-228645378 CCCCCGGTTTGGAAGGGTGCGAC No data
Right 922841137 1:228645404-228645426 TCGCCTGGGCGTTCCGGGAGCGG No data
922841124_922841134 11 Left 922841124 1:228645356-228645378 CCCCCGGTTTGGAAGGGTGCGAC No data
Right 922841134 1:228645390-228645412 ATGGGTGAATTGAATCGCCTGGG No data
922841124_922841136 20 Left 922841124 1:228645356-228645378 CCCCCGGTTTGGAAGGGTGCGAC No data
Right 922841136 1:228645399-228645421 TTGAATCGCCTGGGCGTTCCGGG No data
922841124_922841138 26 Left 922841124 1:228645356-228645378 CCCCCGGTTTGGAAGGGTGCGAC No data
Right 922841138 1:228645405-228645427 CGCCTGGGCGTTCCGGGAGCGGG No data
922841124_922841135 19 Left 922841124 1:228645356-228645378 CCCCCGGTTTGGAAGGGTGCGAC No data
Right 922841135 1:228645398-228645420 ATTGAATCGCCTGGGCGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922841124 Original CRISPR GTCGCACCCTTCCAAACCGG GGG (reversed) Intergenic
No off target data available for this crispr