ID: 922841127

View in Genome Browser
Species Human (GRCh38)
Location 1:228645359-228645381
Sequence GTCGTCGCACCCTTCCAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922841127_922841137 22 Left 922841127 1:228645359-228645381 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922841137 1:228645404-228645426 TCGCCTGGGCGTTCCGGGAGCGG No data
922841127_922841136 17 Left 922841127 1:228645359-228645381 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922841136 1:228645399-228645421 TTGAATCGCCTGGGCGTTCCGGG No data
922841127_922841138 23 Left 922841127 1:228645359-228645381 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922841138 1:228645405-228645427 CGCCTGGGCGTTCCGGGAGCGGG No data
922841127_922841133 7 Left 922841127 1:228645359-228645381 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922841133 1:228645389-228645411 GATGGGTGAATTGAATCGCCTGG No data
922841127_922841130 -10 Left 922841127 1:228645359-228645381 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922841130 1:228645372-228645394 GTGCGACGACGGCGCCCGATGGG No data
922841127_922841140 27 Left 922841127 1:228645359-228645381 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922841140 1:228645409-228645431 TGGGCGTTCCGGGAGCGGGAAGG No data
922841127_922841134 8 Left 922841127 1:228645359-228645381 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922841134 1:228645390-228645412 ATGGGTGAATTGAATCGCCTGGG No data
922841127_922841135 16 Left 922841127 1:228645359-228645381 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922841135 1:228645398-228645420 ATTGAATCGCCTGGGCGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922841127 Original CRISPR GTCGTCGCACCCTTCCAAAC CGG (reversed) Intergenic
No off target data available for this crispr