ID: 922841129

View in Genome Browser
Species Human (GRCh38)
Location 1:228645371-228645393
Sequence GGTGCGACGACGGCGCCCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922841114_922841129 7 Left 922841114 1:228645341-228645363 CCCTGCCCGCCCCTTCCCCCGGT No data
Right 922841129 1:228645371-228645393 GGTGCGACGACGGCGCCCGATGG No data
922841126_922841129 -10 Left 922841126 1:228645358-228645380 CCCGGTTTGGAAGGGTGCGACGA No data
Right 922841129 1:228645371-228645393 GGTGCGACGACGGCGCCCGATGG No data
922841112_922841129 8 Left 922841112 1:228645340-228645362 CCCCTGCCCGCCCCTTCCCCCGG 0: 22
1: 4
2: 8
3: 139
4: 1138
Right 922841129 1:228645371-228645393 GGTGCGACGACGGCGCCCGATGG No data
922841117_922841129 2 Left 922841117 1:228645346-228645368 CCCGCCCCTTCCCCCGGTTTGGA No data
Right 922841129 1:228645371-228645393 GGTGCGACGACGGCGCCCGATGG No data
922841123_922841129 -4 Left 922841123 1:228645352-228645374 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922841129 1:228645371-228645393 GGTGCGACGACGGCGCCCGATGG No data
922841111_922841129 14 Left 922841111 1:228645334-228645356 CCGCTGCCCCTGCCCGCCCCTTC No data
Right 922841129 1:228645371-228645393 GGTGCGACGACGGCGCCCGATGG No data
922841118_922841129 1 Left 922841118 1:228645347-228645369 CCGCCCCTTCCCCCGGTTTGGAA No data
Right 922841129 1:228645371-228645393 GGTGCGACGACGGCGCCCGATGG No data
922841115_922841129 6 Left 922841115 1:228645342-228645364 CCTGCCCGCCCCTTCCCCCGGTT No data
Right 922841129 1:228645371-228645393 GGTGCGACGACGGCGCCCGATGG No data
922841110_922841129 15 Left 922841110 1:228645333-228645355 CCCGCTGCCCCTGCCCGCCCCTT No data
Right 922841129 1:228645371-228645393 GGTGCGACGACGGCGCCCGATGG No data
922841120_922841129 -2 Left 922841120 1:228645350-228645372 CCCCTTCCCCCGGTTTGGAAGGG No data
Right 922841129 1:228645371-228645393 GGTGCGACGACGGCGCCCGATGG No data
922841122_922841129 -3 Left 922841122 1:228645351-228645373 CCCTTCCCCCGGTTTGGAAGGGT No data
Right 922841129 1:228645371-228645393 GGTGCGACGACGGCGCCCGATGG No data
922841125_922841129 -9 Left 922841125 1:228645357-228645379 CCCCGGTTTGGAAGGGTGCGACG No data
Right 922841129 1:228645371-228645393 GGTGCGACGACGGCGCCCGATGG No data
922841124_922841129 -8 Left 922841124 1:228645356-228645378 CCCCCGGTTTGGAAGGGTGCGAC No data
Right 922841129 1:228645371-228645393 GGTGCGACGACGGCGCCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922841129 Original CRISPR GGTGCGACGACGGCGCCCGA TGG Intergenic
No off target data available for this crispr