ID: 922841132

View in Genome Browser
Species Human (GRCh38)
Location 1:228645387-228645409
Sequence AGGCGATTCAATTCACCCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922841132_922841137 -6 Left 922841132 1:228645387-228645409 CCGATGGGTGAATTGAATCGCCT No data
Right 922841137 1:228645404-228645426 TCGCCTGGGCGTTCCGGGAGCGG No data
922841132_922841144 16 Left 922841132 1:228645387-228645409 CCGATGGGTGAATTGAATCGCCT No data
Right 922841144 1:228645426-228645448 GGAAGGCACCGCGAACGGCAGGG No data
922841132_922841143 15 Left 922841132 1:228645387-228645409 CCGATGGGTGAATTGAATCGCCT No data
Right 922841143 1:228645425-228645447 GGGAAGGCACCGCGAACGGCAGG No data
922841132_922841140 -1 Left 922841132 1:228645387-228645409 CCGATGGGTGAATTGAATCGCCT No data
Right 922841140 1:228645409-228645431 TGGGCGTTCCGGGAGCGGGAAGG No data
922841132_922841138 -5 Left 922841132 1:228645387-228645409 CCGATGGGTGAATTGAATCGCCT No data
Right 922841138 1:228645405-228645427 CGCCTGGGCGTTCCGGGAGCGGG No data
922841132_922841142 11 Left 922841132 1:228645387-228645409 CCGATGGGTGAATTGAATCGCCT No data
Right 922841142 1:228645421-228645443 GAGCGGGAAGGCACCGCGAACGG No data
922841132_922841146 26 Left 922841132 1:228645387-228645409 CCGATGGGTGAATTGAATCGCCT No data
Right 922841146 1:228645436-228645458 GCGAACGGCAGGGAACCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922841132 Original CRISPR AGGCGATTCAATTCACCCAT CGG (reversed) Intergenic
No off target data available for this crispr