ID: 922841133

View in Genome Browser
Species Human (GRCh38)
Location 1:228645389-228645411
Sequence GATGGGTGAATTGAATCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922841114_922841133 25 Left 922841114 1:228645341-228645363 CCCTGCCCGCCCCTTCCCCCGGT No data
Right 922841133 1:228645389-228645411 GATGGGTGAATTGAATCGCCTGG No data
922841120_922841133 16 Left 922841120 1:228645350-228645372 CCCCTTCCCCCGGTTTGGAAGGG No data
Right 922841133 1:228645389-228645411 GATGGGTGAATTGAATCGCCTGG No data
922841112_922841133 26 Left 922841112 1:228645340-228645362 CCCCTGCCCGCCCCTTCCCCCGG 0: 22
1: 4
2: 8
3: 139
4: 1138
Right 922841133 1:228645389-228645411 GATGGGTGAATTGAATCGCCTGG No data
922841124_922841133 10 Left 922841124 1:228645356-228645378 CCCCCGGTTTGGAAGGGTGCGAC No data
Right 922841133 1:228645389-228645411 GATGGGTGAATTGAATCGCCTGG No data
922841117_922841133 20 Left 922841117 1:228645346-228645368 CCCGCCCCTTCCCCCGGTTTGGA No data
Right 922841133 1:228645389-228645411 GATGGGTGAATTGAATCGCCTGG No data
922841118_922841133 19 Left 922841118 1:228645347-228645369 CCGCCCCTTCCCCCGGTTTGGAA No data
Right 922841133 1:228645389-228645411 GATGGGTGAATTGAATCGCCTGG No data
922841125_922841133 9 Left 922841125 1:228645357-228645379 CCCCGGTTTGGAAGGGTGCGACG No data
Right 922841133 1:228645389-228645411 GATGGGTGAATTGAATCGCCTGG No data
922841122_922841133 15 Left 922841122 1:228645351-228645373 CCCTTCCCCCGGTTTGGAAGGGT No data
Right 922841133 1:228645389-228645411 GATGGGTGAATTGAATCGCCTGG No data
922841126_922841133 8 Left 922841126 1:228645358-228645380 CCCGGTTTGGAAGGGTGCGACGA No data
Right 922841133 1:228645389-228645411 GATGGGTGAATTGAATCGCCTGG No data
922841127_922841133 7 Left 922841127 1:228645359-228645381 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922841133 1:228645389-228645411 GATGGGTGAATTGAATCGCCTGG No data
922841115_922841133 24 Left 922841115 1:228645342-228645364 CCTGCCCGCCCCTTCCCCCGGTT No data
Right 922841133 1:228645389-228645411 GATGGGTGAATTGAATCGCCTGG No data
922841123_922841133 14 Left 922841123 1:228645352-228645374 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922841133 1:228645389-228645411 GATGGGTGAATTGAATCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922841133 Original CRISPR GATGGGTGAATTGAATCGCC TGG Intergenic
No off target data available for this crispr