ID: 922841135

View in Genome Browser
Species Human (GRCh38)
Location 1:228645398-228645420
Sequence ATTGAATCGCCTGGGCGTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922841117_922841135 29 Left 922841117 1:228645346-228645368 CCCGCCCCTTCCCCCGGTTTGGA No data
Right 922841135 1:228645398-228645420 ATTGAATCGCCTGGGCGTTCCGG No data
922841127_922841135 16 Left 922841127 1:228645359-228645381 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922841135 1:228645398-228645420 ATTGAATCGCCTGGGCGTTCCGG No data
922841126_922841135 17 Left 922841126 1:228645358-228645380 CCCGGTTTGGAAGGGTGCGACGA No data
Right 922841135 1:228645398-228645420 ATTGAATCGCCTGGGCGTTCCGG No data
922841122_922841135 24 Left 922841122 1:228645351-228645373 CCCTTCCCCCGGTTTGGAAGGGT No data
Right 922841135 1:228645398-228645420 ATTGAATCGCCTGGGCGTTCCGG No data
922841118_922841135 28 Left 922841118 1:228645347-228645369 CCGCCCCTTCCCCCGGTTTGGAA No data
Right 922841135 1:228645398-228645420 ATTGAATCGCCTGGGCGTTCCGG No data
922841125_922841135 18 Left 922841125 1:228645357-228645379 CCCCGGTTTGGAAGGGTGCGACG No data
Right 922841135 1:228645398-228645420 ATTGAATCGCCTGGGCGTTCCGG No data
922841124_922841135 19 Left 922841124 1:228645356-228645378 CCCCCGGTTTGGAAGGGTGCGAC No data
Right 922841135 1:228645398-228645420 ATTGAATCGCCTGGGCGTTCCGG No data
922841123_922841135 23 Left 922841123 1:228645352-228645374 CCTTCCCCCGGTTTGGAAGGGTG No data
Right 922841135 1:228645398-228645420 ATTGAATCGCCTGGGCGTTCCGG No data
922841120_922841135 25 Left 922841120 1:228645350-228645372 CCCCTTCCCCCGGTTTGGAAGGG No data
Right 922841135 1:228645398-228645420 ATTGAATCGCCTGGGCGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922841135 Original CRISPR ATTGAATCGCCTGGGCGTTC CGG Intergenic
No off target data available for this crispr