ID: 922841140

View in Genome Browser
Species Human (GRCh38)
Location 1:228645409-228645431
Sequence TGGGCGTTCCGGGAGCGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922841126_922841140 28 Left 922841126 1:228645358-228645380 CCCGGTTTGGAAGGGTGCGACGA No data
Right 922841140 1:228645409-228645431 TGGGCGTTCCGGGAGCGGGAAGG No data
922841131_922841140 0 Left 922841131 1:228645386-228645408 CCCGATGGGTGAATTGAATCGCC No data
Right 922841140 1:228645409-228645431 TGGGCGTTCCGGGAGCGGGAAGG No data
922841124_922841140 30 Left 922841124 1:228645356-228645378 CCCCCGGTTTGGAAGGGTGCGAC No data
Right 922841140 1:228645409-228645431 TGGGCGTTCCGGGAGCGGGAAGG No data
922841125_922841140 29 Left 922841125 1:228645357-228645379 CCCCGGTTTGGAAGGGTGCGACG No data
Right 922841140 1:228645409-228645431 TGGGCGTTCCGGGAGCGGGAAGG No data
922841127_922841140 27 Left 922841127 1:228645359-228645381 CCGGTTTGGAAGGGTGCGACGAC No data
Right 922841140 1:228645409-228645431 TGGGCGTTCCGGGAGCGGGAAGG No data
922841132_922841140 -1 Left 922841132 1:228645387-228645409 CCGATGGGTGAATTGAATCGCCT No data
Right 922841140 1:228645409-228645431 TGGGCGTTCCGGGAGCGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922841140 Original CRISPR TGGGCGTTCCGGGAGCGGGA AGG Intergenic
No off target data available for this crispr