ID: 922841143

View in Genome Browser
Species Human (GRCh38)
Location 1:228645425-228645447
Sequence GGGAAGGCACCGCGAACGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922841131_922841143 16 Left 922841131 1:228645386-228645408 CCCGATGGGTGAATTGAATCGCC No data
Right 922841143 1:228645425-228645447 GGGAAGGCACCGCGAACGGCAGG No data
922841132_922841143 15 Left 922841132 1:228645387-228645409 CCGATGGGTGAATTGAATCGCCT No data
Right 922841143 1:228645425-228645447 GGGAAGGCACCGCGAACGGCAGG No data
922841139_922841143 -5 Left 922841139 1:228645407-228645429 CCTGGGCGTTCCGGGAGCGGGAA No data
Right 922841143 1:228645425-228645447 GGGAAGGCACCGCGAACGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922841143 Original CRISPR GGGAAGGCACCGCGAACGGC AGG Intergenic
No off target data available for this crispr