ID: 922847428

View in Genome Browser
Species Human (GRCh38)
Location 1:228698653-228698675
Sequence ATGCCCATCCAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922847426_922847428 3 Left 922847426 1:228698627-228698649 CCATGGAAGAAAAGACCTAACAA No data
Right 922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922847428 Original CRISPR ATGCCCATCCAGAAGAGTGA AGG Intergenic
No off target data available for this crispr