ID: 922854333

View in Genome Browser
Species Human (GRCh38)
Location 1:228761152-228761174
Sequence TTGTGGGTAGGGCAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922854322_922854333 14 Left 922854322 1:228761115-228761137 CCAAAGAACGTAGGGATTTTCGC No data
Right 922854333 1:228761152-228761174 TTGTGGGTAGGGCAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922854333 Original CRISPR TTGTGGGTAGGGCAGGGGGA GGG Intergenic
No off target data available for this crispr