ID: 922854333 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:228761152-228761174 |
Sequence | TTGTGGGTAGGGCAGGGGGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
922854322_922854333 | 14 | Left | 922854322 | 1:228761115-228761137 | CCAAAGAACGTAGGGATTTTCGC | No data | ||
Right | 922854333 | 1:228761152-228761174 | TTGTGGGTAGGGCAGGGGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
922854333 | Original CRISPR | TTGTGGGTAGGGCAGGGGGA GGG | Intergenic | ||
No off target data available for this crispr |