ID: 922855163

View in Genome Browser
Species Human (GRCh38)
Location 1:228768954-228768976
Sequence CTTTATGAGGGGAGTACAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922855163_922855172 -4 Left 922855163 1:228768954-228768976 CCTACTGTACTCCCCTCATAAAG No data
Right 922855172 1:228768973-228768995 AAAGCGGGGGGCCTTCGCAATGG No data
922855163_922855177 21 Left 922855163 1:228768954-228768976 CCTACTGTACTCCCCTCATAAAG No data
Right 922855177 1:228768998-228769020 AAGCCAGGCAAACACCACGTCGG No data
922855163_922855174 -2 Left 922855163 1:228768954-228768976 CCTACTGTACTCCCCTCATAAAG No data
Right 922855174 1:228768975-228768997 AGCGGGGGGCCTTCGCAATGGGG No data
922855163_922855175 6 Left 922855163 1:228768954-228768976 CCTACTGTACTCCCCTCATAAAG No data
Right 922855175 1:228768983-228769005 GCCTTCGCAATGGGGAAGCCAGG No data
922855163_922855173 -3 Left 922855163 1:228768954-228768976 CCTACTGTACTCCCCTCATAAAG No data
Right 922855173 1:228768974-228768996 AAGCGGGGGGCCTTCGCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922855163 Original CRISPR CTTTATGAGGGGAGTACAGT AGG (reversed) Intergenic
No off target data available for this crispr