ID: 922857304

View in Genome Browser
Species Human (GRCh38)
Location 1:228785887-228785909
Sequence TCATGGCAGAGACGCTTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922857304_922857309 24 Left 922857304 1:228785887-228785909 CCCGTCAAGCGTCTCTGCCATGA No data
Right 922857309 1:228785934-228785956 TCAGCCTCCTCCTTAGCACCAGG No data
922857304_922857310 25 Left 922857304 1:228785887-228785909 CCCGTCAAGCGTCTCTGCCATGA No data
Right 922857310 1:228785935-228785957 CAGCCTCCTCCTTAGCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922857304 Original CRISPR TCATGGCAGAGACGCTTGAC GGG (reversed) Intergenic
No off target data available for this crispr