ID: 922857305

View in Genome Browser
Species Human (GRCh38)
Location 1:228785888-228785910
Sequence ATCATGGCAGAGACGCTTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922857305_922857309 23 Left 922857305 1:228785888-228785910 CCGTCAAGCGTCTCTGCCATGAT No data
Right 922857309 1:228785934-228785956 TCAGCCTCCTCCTTAGCACCAGG No data
922857305_922857310 24 Left 922857305 1:228785888-228785910 CCGTCAAGCGTCTCTGCCATGAT No data
Right 922857310 1:228785935-228785957 CAGCCTCCTCCTTAGCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922857305 Original CRISPR ATCATGGCAGAGACGCTTGA CGG (reversed) Intergenic