ID: 922857306

View in Genome Browser
Species Human (GRCh38)
Location 1:228785904-228785926
Sequence TGCGTGGTGTGGCTACATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922857306_922857309 7 Left 922857306 1:228785904-228785926 CCATGATGTAGCCACACCACGCA No data
Right 922857309 1:228785934-228785956 TCAGCCTCCTCCTTAGCACCAGG No data
922857306_922857310 8 Left 922857306 1:228785904-228785926 CCATGATGTAGCCACACCACGCA No data
Right 922857310 1:228785935-228785957 CAGCCTCCTCCTTAGCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922857306 Original CRISPR TGCGTGGTGTGGCTACATCA TGG (reversed) Intergenic
No off target data available for this crispr