ID: 922857307

View in Genome Browser
Species Human (GRCh38)
Location 1:228785915-228785937
Sequence CTGAACAGTGATGCGTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922857307_922857309 -4 Left 922857307 1:228785915-228785937 CCACACCACGCATCACTGTTCAG No data
Right 922857309 1:228785934-228785956 TCAGCCTCCTCCTTAGCACCAGG No data
922857307_922857310 -3 Left 922857307 1:228785915-228785937 CCACACCACGCATCACTGTTCAG No data
Right 922857310 1:228785935-228785957 CAGCCTCCTCCTTAGCACCAGGG No data
922857307_922857316 20 Left 922857307 1:228785915-228785937 CCACACCACGCATCACTGTTCAG No data
Right 922857316 1:228785958-228785980 CCTACACTTTCTCGCAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922857307 Original CRISPR CTGAACAGTGATGCGTGGTG TGG (reversed) Intergenic
No off target data available for this crispr